CPAN install failure "unknown option mafft"

[tseemann]

Mafft is installed and in PATH.
I deleted the original bin/roary from previous install too.
It looks like the FASTA file comparison fails - lower case vs uppercase?

t/Bio/Roary/CommandLine/QueryRoary.t .................... ok
t/Bio/Roary/CommandLine/Roary.t ......................... 46/? Unknown option: mafft
Unknown option: mafft
Unknown option: mafft
Unknown option: mafft
t/Bio/Roary/CommandLine/Roary.t ......................... 48/?
#   Failed test 'Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups  --output_multifasta_files --mafft --dont_delete_files t/data/real_data_1.gff t/data/real_data_2.gff''
#   at t/lib/TestHelper.pm line 75.
# +---+--------------------------------------------------------------+--------------------------------------------------------------+
# |   |Got                                                           |Expected                                                      |
# | Ln|                                                              |                                                              |
# +---+--------------------------------------------------------------+--------------------------------------------------------------+
# |  1|>11111_1#11_04119                                             |>11111_1#11_04119
# *  2|ATGAATAAAACAACTGAGTATATTGACGCACTGCTGCTTTCTGAACGTGAGAAAGCGGCA  |atgaataaaacaactgagtatattgacgcactgctgctttctgaacgtgagaaagcggca  *```

Test Summary Report
-------------------
t/Bio/Roary/CommandLine/Roary.t                       (Wstat: 256 Tests: 50 Failed: 1)
  Failed test:  49
  Non-zero exit status: 1
Files=48, Tests=704, 140 wallclock secs ( 0.17 usr  0.05 sys + 73.77 cusr 26.66 csys = 100.65 CPU)
Result: FAIL
Failed 1/48 test programs. 1/704 subtests failed.
make: *** [test_dynamic] Error 255
  AJPAGE/Bio-Roary-3.2.4.tar.gz
  /bin/make test -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
  reports AJPAGE/Bio-Roary-3.2.4.tar.gz
Stopping: 'install' failed for 'Bio::Roary'.
Failed during this command:
 AJPAGE/Bio-Roary-3.2.4.tar.gz                : make_test NO

[andrewjpage]

It should be fixed in version https://github.com/sanger-pathogens/Roary/tree/v3.2.8