Initial commit

Author: github-classroom[bot]

.github/workflows/classroom.yml

@@ -0,0 +1,28 @@
+name: Autograding Tests
+'on':
+- push
+- repository_dispatch
+permissions:
+  checks: write
+  actions: read
+  contents: read
+jobs:
+  run-autograding-tests:
+    runs-on: ubuntu-latest
+    if: github.actor != 'github-classroom[bot]'
+    steps:
+    - name: Checkout code
+      uses: actions/checkout@v4
+    - name: ".tests/orf_test.py"
+      id: tests-orf-test-py
+      uses: classroom-resources/autograding-python-grader@v1
+      with:
+        timeout: 10
+        max-score: 10
+        setup-command: ''
+    - name: Autograding Reporter
+      uses: classroom-resources/autograding-grading-reporter@v1
+      env:
+        TESTS-ORF-TEST-PY_RESULTS: "${{steps.tests-orf-test-py.outputs.result}}"
+      with:
+        runners: tests-orf-test-py

.tests/orf_test.py

@@ -0,0 +1,35 @@
+
+from orf import find_all_starts, find_first_in_register_stop, all_orfs_range, longest_orf
+
+def test_find_all_starts():
+    assert find_all_starts("") == list()
+    assert find_all_starts("GGAGACGACGCAAAAC") == list()
+    assert find_all_starts("AAAAAAATGAAATGAGGGGGGTATG") == [6, 11, 22]
+    assert find_all_starts("GGATGATGATGTAAAAC") == [2, 5, 8]
+    assert find_all_starts("GGATGCATGATGTAGAAC") == [2, 6, 9]
+    assert find_all_starts("GGGATGATGATGGGATGGTGAGTAGGGTAAG") == [3, 6, 9, 14]
+    assert find_all_starts("GGGatgatgatgGGatgGtgaGtagGGACtaaG".upper()) == [3, 6, 9, 14]
+
+def test_find_first_in_register_stop():
+    assert find_first_in_register_stop("") == -1
+    assert find_first_in_register_stop("GTAATAGTGA") == -1
+    assert find_first_in_register_stop("AAAAAAAAAAAAAAATAAGGGTAA") == 18
+    assert find_first_in_register_stop("AAAAAACACCGCGTGTACTGA") == 21
+
+def test_all_orfs():
+    assert all_orfs_range("") == list()
+    assert all_orfs_range("GGAGACGACGCAAAAC") == list()
+    assert all_orfs_range("AAAAAAATGAAATGAGGGGGGTATG") == [(6, 15)]
+    assert all_orfs_range("GGATGATGATGTAAAAC") == [(2, 14),(5, 14),(8,14)]
+    assert all_orfs_range("GGATGCATGATGTAGAAC") == [(6, 15), (9, 15)]
+    assert all_orfs_range("GGGATGATGATGGGATGGTGAGTAGGGTAAG") == [(3, 21),(6, 21), (9, 21)]
+    assert all_orfs_range("GGGatgatgatgGGatgGtgaGtagGGACtaaG".upper()) == [(3, 21), (6, 21), (9, 21), (14, 32)]
+
+def test_longest_orf():
+    assert longest_orf("") == ""
+    assert longest_orf("GGAGACGACGCAAAAC") == ""
+    assert longest_orf("AAAAAAATGAAATGAGGGGGGTATG") == "ATGAAATGA"
+    assert longest_orf("GGATGATGATGTAAAAC") == "ATGATGATGTAA"
+    assert longest_orf("GGATGCATGATGTAGAAC") == "ATGATGTAG"
+    assert longest_orf("GGGATGATGATGGGATGGTGAGTAGGGTAAG") == "ATGATGATGGGATGGTGA"
+    assert longest_orf("GGGatgatgatgGGatgGtgaGtagGGACtaaG") in ["atgGtgaGtagGGACtaa","atgatgatgGGatgGtga"]

README.md

@@ -0,0 +1,28 @@
+# DNA Sequence Analysis Toolkit
+
+This toolkit provides a series of functions for analyzing DNA sequences to identify codon patterns, open reading frames (ORFs), and the longest ORF within a sequence.
+
+## Overview
+
+The project is divided into the following steps:
+
+1. **Finding all start codons**: Locate all occurrences of the `ATG` start codon.
+2. **Finding in-register stop codons**: Identify the first stop codon (`TGA`, `TAG`, or `TAA`) in-frame.
+3. **Identifying all ORFs**: Determine the ranges of all open reading frames in the sequence.
+4. **Finding the longest ORF**: Extract the longest open reading frame from the sequence.
+
+---
+
+## Steps and Implementation Details
+
+### Step 1: Implementing the `find_all_starts` Function
+This function scans a DNA sequence and identifies all starting positions of the `ATG` codon.
+
+### Step 2: Implementing the `find_first_in_register_stop` Function
+You will write a function called find_first_in_register_stop that scans a DNA sequence and identifies the first occurrence of a stop codon (`TGA`, `TAG`, or `TAA`) in the register (every 3 nucleotides). If the stop codon is not found, the function will return -1.
+
+### Step 3: Implementing the `all_orfs_range` Function
+You will implement a function called all_orfs_range that scans a DNA sequence and identifies all open reading frames (ORFs) by finding the start codons (`ATG`) and the corresponding stop codons (`TGA`, `TAG`, `TAA`), and returns the range of each ORF.
+
+### Step 4: Implementing the `longest_orf` Function
+You will implement a function called longest_orf that scans a DNA sequence, finds all open reading frames (ORFs), and returns the longest ORF from the sequence.

orf.ipynb

@@ -0,0 +1,18 @@
+def find_all_starts(dna):
+    pass # Replace the `pass` with your code
+
+
+def find_first_in_register_stop(dna):
+    pass # Replace the `pass` with your code
+
+
+def all_orfs_range(dna):
+    pass # Replace the `pass` with your code
+
+
+def longest_orf(dna):
+    pass # Replace the `pass` with your code
+
+
+
+

orf.py

@@ -0,0 +1,29 @@
+def find_all_starts(dna):
+    starts = []
+    for i in range(len(dna)):
+        if dna[i: i+3] == "ATG":
+            starts.append(i)
+    return starts
+
+def find_first_in_register_stop(dna):
+    for i in range(0, len(dna), 3):
+        if dna[i:i+3] in ["TGA", "TAG", "TAA"]:
+            return i+3
+    return -1
+
+def all_orfs_range(dna):
+    starts = find_all_starts(dna)
+    orfs_ranges = []
+    for start in starts:
+        end = find_first_in_register_stop(dna[start:])
+        if end != -1:
+            orfs_ranges.append((start, start+end))
+    return orfs_ranges
+
+def longest_orf(dna):
+    longest = ""
+    for orf_range in all_orfs_range(dna.upper()):
+        orf = dna[orf_range[0]: orf_range[1]]
+        if len(orf) > len(longest):
+            longest = orf
+    return longest