TP04_Manual_PCR_simulation\TP04_Manual_PCR_simulation
PCR prediction given primer and template sequences
The objective of this document is to teach how to assemble the sequence of a PCR product when you have access to both sequences of the primers and the template.
Primers, which are single stranded DNA molecules used in PCR, are usually at least 16 nucleotides (nt) long and template sequences are usually at least 100 nt long. In the examples in this document, both primers and template are much shorter for clarity.
It is necessary to have a basic understanding of the principles of PCR before solving the exercises.
The primers “forward” and “reverse” can be used to amplify the DNA molecule “template” (Fig 1)
The FASTA sequences for the primers represent single stranded DNA while the template is double stranded and represents this molecule in reality (Fig 2):
We call the upper strand Watson and the lower strand Crick in the example above (Fig 2). In the first cycle of PCR, the strands are separated by heating. After cooling, the forward and reverse primers then anneal as shown below. The “forward” primer anneals to the Crick strand while the “reverse” primer anneals to the Watson strand (Fig 3).
Compare the reverse primer in Fig 3 with the with the one in the FASTA sequence in Fig 1. It is evident that the sequence in Fig 3 is the reverse of the one in Fig 1. DNA polymerase (such as Taq) synthesize a new strand in the 5'-3' direction (indicated by < and >).
As you can see above, the primers are incorporated in the newly synthesized DNA strands and become a part of the final PCR product. Theoretically, in each cycle, one new DNA strand (Watson or Crick) is produced from each existing strand, so that there is a doubling of strands with each cycle. This doubling of the number of DNA molecules with each cycle is a exponential increase with time and the reason why the process is called “chain reaction”.
It is important to understand that what we call forward and reverse primer is simply a convention. As you probably know we can choose to view the crick strand instead of the Watson strand:
This is exactly the same molecule as in Fig 2. The primers now anneal like this:
Note that the previous forward primer is now reverse and that the forward is now reverse. What is forward and reverse primer is up to the designer of the primers.
Question 1:
Predict the sequence of the PCR product from the primers and template below:
>f
aactatc
>r
ctatcg
>t
cgaactatccacatctcgataga
What is the size of the PCR product?
The uSEGUID of the correct sequence starts with V1tEc
What are the last five letters of the complete lSEGUID?
It is not necessary to produce an elaborate figure as the one above. Suppose you have the primers and the template below:
First find the forward primer in the template (indicated by yellow):
Then make the reverse-complement of the reverse primer (use the function in ApE 
or seguid calculator) (indicated by green):
Find the reverse-complement of the reverse primer in the template:
The sequence of the PCR product is the sequence between the primers including the primers.
You can of course do the reverse in order to design PCR primers for a certain sequence. Use of the reverse-complement function makes it unnecessary to consider the Crick strand.
Make sure you understand why.
Question 2:
Design two primers called F2 and R2 that are each six nucleotides long to amplify the entire template sequence:
>template
tgatctactgatcaatatgccgacgagact
>F2
?
>R2
?
Calculate the uSEGUIDs for F2 and R2 after you have designed them.
uSEGUID for F2 starts with: sPQWc
What are the last five characters of the uSEGUID?
uSEGUID for R2 starts with: UwV1H
What are the last five characters of the uSEGUID?
Question 3:
Design two primers called F3 and R3 that are each six nucleotides long to amplify the template sequence from (and including) nucleotide 6 to 25, so that the PCR product is exactly 20 nucleotides long.
Tip! You can use ApE for this, choose Edit>Select From-To... and enter 6 and 25. Assemble the sequence of the PCR product as well
>template
tgatctactgatcaatatgccgacgagact
>F3
?
>R3
?
>Product3
?
Calculate uSEGUIDs for the three sequences:
| Sequence | uSEGUID first five characters | uSEGUID last 5 characters |
|---|---|---|
| F3 | ep4f2i | ? |
| R3 | I-CUj | ? |
| Product3 | AIWZG | ? |
The following two pages describe the principle of engineering the ends of PCR products. PCR can be used to add specific sequences that are not part of the template to the ends of the PCR product. In this example, we add restriction sites to the PCR product. This is a common method to clone a PCR product in a vector.
Consider the following double stranded DNA molecule:
If we would like to clone the molecule above (which is same as in the first example of this document) we would like to have restriction enzyme sites at the ends of the molecule. Preferably an enzyme that does NOT cut in the interior of the DNA fragment. One such enzyme is BamHI (you can check this using ApE). The recognition sequence of BamHI is GGATCC, so the desired molecule would be:
We can create this molecule by extending our primers with the desired sequence:
These new primers will anneal like this in the very first cycle of PCR:
Note that the extra nucleotides we added do not anneal to the template. DNA polymerase will synthesize new DNA in four places (> < > <). The final molecules will have these structures:
We have two molecules, each with the restriction site in the end. In the next cycle, the primers will add the extra sequence on the other side:
The final product is shown in Fig 18.
Question 4:
Design primers for PCR engineering of EcoRI sites to the ends of the DNA sequence below (template4). The primers (F4 and R4) should be six nucleotides long excluding the EcoRI site sequences. You can find information about EcoRI in ApE, choose Enzymes>Enzyme Selector... Assemble the sequences of F4, R4 and Product4 and calculate the uSEGUIDs for each sequence. Tip! Look at Fig 12 to Fig 18 for an example.
>template4
atatgcatcatctatctacgtagcgtatgctataatcta
>F4
?
>R4
?
>Product4
?
| Sequence | uSEGUID first five characters | uSEGUID last five characters |
|---|---|---|
| F4 | xOCQ9 | ? |
| R4 | 8Slf7 | ? |
| Product4 | nvgc2 | ? |
Question 5:
The sequence template5 is circular. Assemble the sequence of the PCR product (Product5) using primers F5 and R5. The first five character of the uSEGUID for the PCR product is xHaBS, what are the last five?
>template5 circular
atatgcatcatctatctacgtagcgtatgctataatcta
>F5
tagcgt
>R5
agatga
>Product5
?
Question 5:
This is an individual question for each student. Follow this link to a Google Spreadsheet. You should find your name in the leftmost column.
The goal of this exercise is to design two primers for a sequence called geneX. The primers should add flanking restriction sites for two restriction enzymes, Enz#1 and Enz#2. These sites are also present in the vector pUCmu and should be used to simulate cloning of the PCR product in pUCmu resulting a new vector called pUCmu_geneX. Columns in the spreadsheet contain your values for geneX, Enz#1 and Enz#2.
You should also predict the final sequence of pUCmu_geneX. The primers should anneal to the template with 16-18 nucleotides. The sequence of the pUCmu can be found in the file pUCmu.gb in the folder of this file. The cSEGUID of the pUCmu should be wonHpAgf0BcUTNAorUx1-Nkr7xs. Put your answer in the fp, rp and pUCmu_geneX columns. Use raw DNA sequences as indicated for Max Maximus. © Björn Johansson 2022