TP18_assembly_of_the_p416TEF_vector_from_a_published_cloning_strategy\TP18_assembly_of_the_p416TEF_vector_from_a_published_cloning_strategy
The p416TEF vector is a widely used expression vector for S. cerevisiae. It has a TEF2 promoter and a CYC1 terminator controlling the expression of genes that can be cloned using a number of different restriction sites (MCS). The TEF2 promoter is a strong constitutive promoter controlling the expression of Translational elongation factor EF-1 alpha. CYC1 encodes for one of the isoforms of cytochrome c. The CYC1 terminator is also widely used in yeast biotechnology.
The p416TEF was constructed from a vector called pRS416 by cloning two fragments. The cloning strategy is described in Mumberg 1995 (page 120). This section was highlighted in the PDF file “Mumberg_1995.pdf” which you can find in the same folder as this file.
Question1:
Follow the cloning strategy described in Mumberg 1995 to assemble the sequence of the plasmid p416TEF. You can find the pRS416 sequence in the file “pRS416.fasta” in the same folder as this file. Two linear DNA fragments are given below:
>CYC1 terminator XhoI KpnI fragment
CTCGAGTCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCGGCCGGTACC
>TEF2 promoter PCR product SacI XbaI fragment
GAGCTCTTACCCATAAGGTTGTTTGTGACGGCGTCGTACAAGAGAACGTGGGAACTTTTTAGGCTCACCAAAAAAGAAAGAAAAAATACGAGTTGCTGACAGAAGCCTCAAGAAAAAAAAAATTCTTCTTCGACTATGCTGGAGGCAGAGATGATCGAGCCGGTAGTTAACTATATATAGCTAAATTGGTTCCATCACCTTCTTTTCTGGTGTCGCTCCTTCTAGTGCTATTTCTGGCTTTTCCTATTTTTTTTTTTCCATTTTTCTTTCTCTCTTTCTAATATATAAATTCTCTTGCATTTTCTATTTTTCTCTCTATCTATTCTACTTGTTTATTCCCTTCAAGGTTTTTTTTTAAGGAGTACTTGTTTTTAGAATATACGGTCAACGAACTATAATTAACTAAACTCTAGA
The first five letters of the cSEGUID for p416TEF is 1S1RG. What are the last five letters of the cSEGUID?