Report insertions stripped during alignment

[jameshadfield]

Motivated by a comment in today's lab meeting this PR reports insertions in augur align which are removed as we (typically) strip to reference.

It (a) prints them to screen and (b) produces a CSV you can drag&drop onto auspice to view the insertions. Numbering is GFF style -- 1 based, insertion to the right.

E.g. here's (some) of the output from a zika run:

...
1bp insertion at ref position 309
        A: USA/2016/FLUR001
182bp insertion at ref position 465
        WARNING: this insertion was caused due to 'N's or '?'s in provided sequences
...
87bp insertion at ref position 10769
        TGTGGGGAAATCCATGGGTCT: SI_BKK05, BKK03, BKK04, SI_BKK02, SI_BKK06, Brazil/PE243/2015, H/PF/2013, TS17_2016, Paraiba_01, V15261, V15098, RIO_BM1, Rio_U1, PAN/CDC_259359_V1_V3/2015, PAN/CDC_259364_V1_V2/2015, FLA, PAN/BEI_259634_V4/2016, COL/FLR/2015, Rio_S1, CTS_30_16p, CTS_50_16p, CTS_36_16p, CTS_61_16p, CTS_47_16p, CTS_56_16p, CTS_193_16p, CTS_178_16p, V16288, SL1602, CTS_183_16p, CTS_223_16p, ZKC2P6, ZKC2/2016, ZKC2P4, QTX_04, HN16, HND/R103451/2015, V103451, Aedessp/MEX/MEX_2_81/2016, Aedessp/MEX/MEX_I_7/2016, THA/2014/SV0127_14, SV0010/15, SI_BKK01
        TGTGGGGAAATCCATGGGTCTT: mosquito/Haiti/1919/2016, Haiti/1225/2014, Haiti/1/2016, COL/UF_1/2016, VEN/UF_1/2016, Natal_RGN, Zhejiang04, mosquito/Haiti/1855/2016
        TGTGGGGAAATCCATGG: PE243, 31N, V20366
...

and via the auspice visualisation:

---

If we like this direction, there's lots more we can do here, for instance cross reference with the (genbank) reference to see what genes they fall in, translate the insertions if they look like codon insertions etc etc.

[rneher]

I think this is a very useful direction. I tested this a bit and figured it would be better to test in context of master, so merged master into it. works well AFAICT.

[rneher]

@huddlej In this PR by @jameshadfield stripping of insertions and removal of the reference sequence were separated. this messes with quite a few tests...