Broken2merge

Description

The broken2merge software is designed to concatenate the genes that belong to the same species but appear to be broken due to assembly issues. It provides a solution for merging fragmented gene sequences into a single, complete sequence.

Features

• Gene concatenation: broken2merge identify and merge fragmented gene sequences into a single, continuous sequence.
• Assembly error detection: broken2merge includes error detection mechanisms to identify and handle assembly errors, ensuring accurate gene concatenation.

Installation

To install broken2merge, follow these steps:

Install with pipy:

pip install broken2merge

Install in a conda/mamba env:

mamba create -n broken2merge python=3.12 tqdm biopython numpy
conda activate broken2merge
pip install broken2merge

Usage

To use broken2merge:

usage: broken2merge [-h] [-v] [-V] -i FASTA_FILE [-o OUTPUT] [-s SEPARATOR]

Takes a alignement and find genes that seems broken and merge them together

options:
  -h, --help            show this help message and exit

General input dataset options:
  -v, --verbose         Show verbose output. (For debugging purposes)
  -V, --version         Show the version number and exit.
  -i FASTA_FILE, --input FASTA_FILE
                        Path to an input fasta file (Required)
  -o OUTPUT, --output OUTPUT
                        Path of the output folder (Default: merge_broken_res)
  -s SEPARATOR, --separator SEPARATOR
                        Separator to use to split the gene name (Default: ';')
  --force_merge         Force the merge of the genes even if they might be paralogs, will give a unaligned file as main input

Example

Here's an example of how to use broken2merge to merge gene sequences:

broken2merge -i ftsK.aln.fas -o test -s ';'

Here for an input file named ftsK.aln.fas and output folder named test and the separator is ; in the gene name (species_name;gene_name).

Explaination of the concatenation

Case that will be handled:

1. Two genes that do not overlap in the alignment

speciesA_geneA  ------------------atgattgaactcgccc                
speciesA_geneA  atgattgaactcgccc------------------

it will become

speciesA_merge atgattgaactcgcc--catgattgaactcgccc

2. Two genes that overlap and perfectly in the alignment in only one part

speciesA_geneA  ----------------actcgcccatgattgaactcgccc
                                ||||||||
speciesA_geneB  atgattgaactcgcccactcgccc----------------

will become

speciesA_merge atgattgaactcgcccactcgcccatgattgaactcgccc

3. Two genes with a overlap not at the extremity of the gene

speciesA_geneA  ---------------------actcgcccatgattgaactcgccc
                                     ||||||||
speciesA_geneB  atgattgaactcgccc-----actcgccc----------------

will become

speciesA_merge atgattgaactcgccc-----actcgcccatgattgaactcgccc

4. Two genes wit an overlap that is not 100% perfect

speciesA_geneA  ---------------------actcgcccatgattgaactcgccc
                                     || ||| | 
speciesA_geneB  atgattgaactcgccc-----acccgcgc---------------

The sequences will be discarded from the alignement.

If --force_merge is used, it the sequences will be merged with the sequence one after the other in order from the alignement. The output fasta file will unaligned.

it will become

speciesA_merge atgattgaactcgcccacccgcgcactcgcccatgattgaactcgccc