Skip to content
master
Go to file
Code

Latest commit

 

Git stats

Files

Permalink
Failed to load latest commit information.
Type
Name
Latest commit message
Commit time
 
 
m4
 
 
src
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

README.md

RactIP for predicting RNA-RNA interaction using integer programming

Requirements

Install

For GLPK,

./configure --with-vienna-rna=/path/to/vienna-rna --with-glpk

For Gurobi,

./configure --with-vienna-rna=/path/to/vienna-rna --with-gurobi=/path/to/gurobi

For CPLEX,

./configure --with-vienna-rna=/path/to/vienna-rna --with-cplex \
            --with-cplex-include=/path/to/cplex/include \
	        --with-cplex-lib=/path/to/cplex/lib

Then,

make
make install

Usage

RactIP can take two FASTA formatted RNA sequences as input, the predict their joint secondary structures.

Usage: ractip [OPTIONS]... [FILES]...

-h, --help                 Print help and exit
    --full-help            Print help, including hidden options, and exit
-V, --version              Print version and exit
-a, --alpha=FLOAT          weight for hybridization  (default=`0.6')
-b, --beta=FLOAT           weight for accessibility  (default=`0.0')
-t, --fold-th=FLOAT        Threshold for base-pairing probabilities
                           (default=`0.8')
-u, --hybridize-th=FLOAT   Threshold for hybridazation probabilities
                           (default=`0.3')
-s, --acc-th=FLOAT         Threshold for accessible probabilities
                           (default=`0.005')
-e, --show-energy          calculate the free energy of the predicted joint
                           structure  (default=off)

% ractip DIS.fa DIS.fa
>DIS
CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG
((((.(((((((..[[[[[[.)))))))...))))
>DIS
CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG
((((.(((((((..]]]]]].)))))))...))))

The parenthesis '()' and the brackets '[]' indicate the predicted internal base-pairs and external base-pairs (interactions), respectively.

References

  • Kato, Y., Sato, K., Hamada, M., Watanabe, Y., Asai, K., Akutsu, T.: RactIP: fast and accurate prediction of RNA-RNA interaction using integer programming. Bioinformatics, 26(18):i460-i466, 2010.
You can’t perform that action at this time.