Python 3

Practice makes us better; usually debugging makes code closer to perfect. This program is supposed to ask the user to enter a DNA sequence and then output the AT content of the sequence— total number of As and Ts divided by the sequence length—as a fraction of the total sequence length (a number between 0 and 1).

For example, given the string: AAAATGAATGGCTAACTTTTGAA

the program should output: (make sure that you pay attention to the number of significant digits in the output!)

AT content = 0.739