Supported input formats

Supported Input Formats

Barnaba

Barnaba produces two output files per structure: a pairing file and a stacking file. RNA2DUnifier processes the pairing file.

Typical content:

# Loading /data/preprocessed/1YMO_A.pdb
# ./barnaba/bin/barnaba ANNOTATE --pdb /data/preprocessed/1YMO_A.pdb
#RES1       RES2       ANNO
# PDB 1YMO_A.pdb
# sequence G_1_0-G_2_0-C_3_0-...
G_1_0      C_29_0      WCc
G_2_0      C_28_0      WCc
U_5_0      A_25_0      SHc

Each interaction line contains two residue identifiers (nucleotide + PDB number) and a Leontis–Westhof annotation in Barnaba's compact notation (e.g., WCc = Watson–Crick/cis).

bpnet

bpnet produces a structured plain-text report. A data line looks like:

5       5   U ? A       25    25   A ? A    W:WC BP 0.24    35    35   A ? A    S:HC TP 1.59

The W:WC token encodes the bond type in BPFIND notation.

FR3D

FR3D outputs JSON. RNA2DUnifier looks for the keys "modified" and "annotations" at the top level.

{
  "pdb_id": "1YMO_A",
  "chain_id": "A",
  "modified": [],
  "annotations": [
    {
      "seq_id1": "19",
      "3d_id1": "19",
      "nt1": "A",
      "unit1": "A",
      "bp": "cWW",
      "seq_id2": "42",
      "nt2": "U",
      "unit2": "U",
      "3d_id2": "42",
      "crossing": "0"
    }
  ]
}

mc-annotate

mc-annotate produces a plain-text report with a Residue conformations section followed by stacking and pairing sections. A pairing line looks like:

A1-A29 : G-C Ww/Ww pairing antiparallel cis XIX

RNApolis

RNApolis output begins with a FASTA-style sequence header (>...) and includes a tabular listing of pairs with the keyword seq. The parser reconstructs the sequence from the header. It uses dot-bracket notation for base pairs.

>strand_A
seq GGGCUGUUUUUCUCGCUGACUUUCAGCCCCAAACAAAAAAGUCAGCA
cWW [[[[[[........((.((((((]]]]]]........)))))).)).

RNAview

RNAview output contains a BEGIN_base-pair block. Interaction lines have the form:

1_29, A:     1 G-C    29 A: +/+ cis         XIX

The last field is the Saenger Classification (e.g., XIX = cWW in Leontis–Westhof notation).

x3dna-DSSR

x3dna-DSSR produces JSON. RNA2DUnifier identifies this format by the presence of the "pairs" key.

{
  "pairs": [
    {
      "index": 1,
      "nt1": "A.G1",
      "nt2": "A.C29",
      "bp": "G-C",
      "name": "WC",
      "Saenger": "19-XIX",
      "LW": "cWW",
      "DSSR": "cW-W"
    }
  ]
}