Primer FASTA Format

Primer FASTA Format

insilicoPCR primer definitions must be provided as a FASTA file.

Each FASTA record ID must end with a role suffix.

Suffix	Meaning
-F	Forward primer
-R	Reverse primer
-P	Probe

The text before the final suffix is treated as the assay, gene, or target name.

For example:

targetA-F
targetA-R
targetA-P

all belong to the same target, targetA.

Primer files in this convention can also be generated rather than written by hand: primer-finder designs selective (q)PCR assays against a group of genomes and writes them as assays_qpcr.fasta (the probe assays, with their -P entries) and assays_pcr.fasta (every assay, primers only), ready to pass to -p.

Standard PCR mode

Use standard PCR mode when every assay has only a forward and reverse primer.

>toxA-F
ATGCGTACGTTAGCTAGCTA
>toxA-R
TCGATCGATACGCGTACGTA

>toxB-F
GCTAGCTAGGATCGATCGAA
>toxB-R
TTCGATCGATCCTAGCTAGC

In standard PCR mode, a target is reported when the forward and reverse primers produce a valid amplicon.

qPCR / probe mode

Use qPCR mode when every assay includes a probe.

>toxA-F
ATGCGTACGTTAGCTAGCTA
>toxA-R
TCGATCGATACGCGTACGTA
>toxA-P
ACGTTAGCTAGCTACGTA

>toxB-F
GCTAGCTAGGATCGATCGAA
>toxB-R
TTCGATCGATCCTAGCTAGC
>toxB-P
CGATCGATCCTAGCTAGC

In qPCR mode, a target is reported as positive only when the forward primer, reverse primer, and probe are detected in the expected amplicon.

Mixing PCR and qPCR assays

Standard PCR assays and qPCR/probe assays can be mixed in the same primer FASTA file (since version 0.8.0). The probe requirement is decided per assay:

• an assay with a -P probe is reported only when the probe is also found inside the amplicon;
• an assay without a probe is reported on its primer pair alone.

When at least one assay defines a probe, the consolidated report includes the probe columns; they are left empty on rows of probe-less assays.

Degenerate bases

Primer sequences may contain standard IUPAC degenerate bases.

Supported bases include:

Code	Bases
R	A or G
Y	C or T
S	C or G
W	A or T
K	G or T
M	A or C
B	C, G, or T
D	A, G, or T
H	A, C, or T
V	A, C, or G
N	A, C, G, or T

Sequences should not include spaces, fluorophore names, quencher names, or non-IUPAC sequence characters. If a probe has labels such as FAM or BHQ1, remove those labels and keep only the nucleotide sequence.

Recommended naming

Use simple names that make the assay clear:

>geneName-F
ACTG...
>geneName-R
CAGT...

Avoid spaces in FASTA IDs. If needed, use underscores or hyphens inside the assay name, but keep the final role suffix as the last part of the ID.

Good:

>speciesA_toxA-F
>speciesA_toxA-R

Avoid:

>speciesA toxA forward
>speciesA-toxA-forward