Tutorial Mixed PCR qPCR

Tutorial: Mixed PCR + qPCR Run with Controls

This tutorial walks through a complete, realistic insilicoPCR run using public data you download yourself — no synthetic sequences. In one single run it combines:

• a conventional PCR assay and a TaqMan qPCR assay in the same primer file (mixed mode),
• a genome assembly (FASTA) and raw Illumina reads (FASTQ) as inputs,
• a positive control (Listeria monocytogenes) and a negative control (Listeria innocua, the classic hly-negative near-neighbor used for exclusivity testing).

Everything below uses the command line from an extracted portable release; the same inputs work in the GUI.

1. The assays

Both assays target hly (listeriolysin O, hlyA), which is present in L. monocytogenes and absent from L. innocua:

Assay	Type	Expected product
hly702	conventional PCR (F + R)	702 bp
hlyQ	TaqMan qPCR (F + R + probe)	112 bp

The hlyQ primers and probe are the hlyA-177 5'-nuclease assay of Nogva et al. 2000, Appl Environ Microbiol 66:4266–4271 (sequences as tabulated by Iwaniak et al. 2017, J Vet Res); the hly702 pair is a widely used conventional hlyA primer set (as tabulated, e.g., in this virulence-gene primer table).

Save this as listeria_assays.fasta:

>hly702-F
CCTAAGACGCCAATCGAA
>hly702-R
AAGCGCTTGCAACTGCTC
>hlyQ-F
TGCAAGTCCTAAGACGCCA
>hlyQ-R
CACTGCATCTCCGTGGTATACTAA
>hlyQ-P
CGATTTCATCCGCGTGTTTCTTTTCG

Note the naming convention: -F/-R/-P suffixes group primers into assays, and the probe-less hly702 assay can share the file with the probe-based hlyQ assay — the probe requirement is applied per assay (see Standard PCR vs qPCR).

2. Download the public data (~100 MB total)

mkdir -p tutorial_input && cd tutorial_input

# Positive control assembly: L. monocytogenes EGD-e reference genome (NCBI)
curl -L -o lmono_EGDe.fasta.gz "https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/196/035/GCF_000196035.1_ASM19603v1/GCF_000196035.1_ASM19603v1_genomic.fna.gz"

# Negative control assembly: L. innocua Clip11262 reference genome (NCBI)
curl -L -o linnocua_CLIP11262.fasta.gz "https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/195/795/GCF_000195795.1_ASM19579v1/GCF_000195795.1_ASM19579v1_genomic.fna.gz"
gunzip *.gz

# Positive control reads: L. monocytogenes Illumina WGS run SRR17090570 (ENA, ~52 MB)
curl -L -O "https://ftp.sra.ebi.ac.uk/vol1/fastq/SRR170/070/SRR17090570/SRR17090570_1.fastq.gz"
curl -L -O "https://ftp.sra.ebi.ac.uk/vol1/fastq/SRR170/070/SRR17090570/SRR17090570_2.fastq.gz"

# Negative control reads: L. innocua Illumina WGS run ERR6501878 (ENA, ~39 MB)
curl -L -O "https://ftp.sra.ebi.ac.uk/vol1/fastq/ERR650/008/ERR6501878/ERR6501878_1.fastq.gz"
curl -L -O "https://ftp.sra.ebi.ac.uk/vol1/fastq/ERR650/008/ERR6501878/ERR6501878_2.fastq.gz"

cd ..

The _1/_2 FASTQ pairs are automatically grouped into one paired-end sample each, and the FASTQ compression is handled transparently.

3. Run insilicoPCR

From the extracted portable release folder:

./runtime/linux/jdk/bin/java -jar insilicoPCR.jar \
  -i tutorial_input/ \
  -p listeria_assays.fasta \
  -o tutorial_results/ \
  -t 8 \
  --gel

What happens, per sample:

• the two assemblies are BLASTed directly against the primer database;
• the two read sets are first baited twice with BBDuk and micro-assembled with Tadpole, and the resulting contigs are BLASTed;
• accepted hits are paired into amplicons (convergent orientation, ≤ 5000 bp by default, perfect 3' ends — see Amplicon Calling);
• --gel additionally renders the synthetic gel image (requires a graphical environment).

The run takes well under a minute on a desktop machine.

4. The consolidated report

tutorial_results/consolidated_report/report.tsv (columns abridged):

Sample	Gene	GenomeLocation	AmpliconSize	Contig	Fwd/Rev mismatches	Strand	Probe	ProbeMismatches
SRR17090570	hly702	660-1361	702	contig_0 (Tadpole)	0 / 0	-
SRR17090570	hlyQ	1257-1368	112	contig_0 (Tadpole)	0 / 0	-	hlyQ-P	0
lmono_EGDe	hly702	205963-206664	702	NC_003210.1	0 / 0	+
lmono_EGDe	hlyQ	205956-206067	112	NC_003210.1	0 / 0	+	hlyQ-P	0

How to read it:

• Both L. monocytogenes samples (assembly and reads) are positive for both assays, with the expected product sizes (702 bp and 112 bp) and zero mismatches.
• The hlyQ rows carry the probe columns — the probe was found inside the amplicon, which is required for a qPCR assay to be called positive. The conventional hly702 rows leave the probe columns empty.
• The hly coordinates from the read samples differ from the EGD-e coordinates because they are positions on the Tadpole-assembled contig, not on a reference genome.
• Strand is - for the read sample: Tadpole happened to assemble the hly region in the opposite orientation, so the assay matched the reverse strand — a reminder that assays are detected on either strand.
• Neither L. innocua sample produces a row: the primers have no acceptable binding sites. An empty result for the negative control is the expected outcome. (You may notice a harmless Warning: [blastn] Query is Empty! in the console: baiting the L. innocua reads with hly primers catches nothing, so there is no assembly to search.)
• Bonus insight: this L. monocytogenes strain carries a single SNP at position 4 (from the 5' end) of hly702-R, visible in detailed_report/SRR17090570/SRR17090570.tsv as a 5'-trimmed alignment. 5'-proximal mismatches barely affect priming, so the hit is accepted (--5p-truncation, default 5) — exactly what a real PCR would do.

5. The synthetic gel

--gel wrote tutorial_results/synthetic_gel_report.png:

Each positive lane shows the two bands you would expect on a real gel — the 702 bp conventional product and the 112 bp qPCR product — while the negative-control lanes are loaded but empty, exactly like a wet-lab exclusivity control. Bands are colored by assay with a gene legend, matching the "Color by gene" option of the interactive GUI viewer (View Gel Image), which additionally offers hover tooltips, pagination, and SVG/PDF export.

6. Things to try next

• Re-run with -m 2 and watch the report stay identical — the assays match their target perfectly, and near-neighbor sites still fail the 3'-end rules.
• Re-run with -l 100: the 112 bp qPCR product now exceeds the maximum length and disappears; --min-length 200 would drop it too.
• Add your own assay for a different gene to the primer FASTA — mixed files are fine as long as every ID ends in -F, -R, or -P.
• Open tutorial_results/detailed_report/<sample>/<sample>.tsv to audit the raw BLAST hits behind every call.