hgbrian/deepbind
Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
DEEPBIND v0.1 ------------- The deepbind command-line executable can be used to score DNA/RNA sequences according to any RBP/TF model listed in the DeepBind web repository: http://tools.genes.toronto.edu/deepbind For each input sequence, the deepbind executable scores each subsequence of a pre-determined length (e.g. 20) and returns only the maximum score over all positions. EXAMPLE ------- To generate predictions with DeepBind, you need two things: 1) a list of model IDs, and 2) a list of DNA/RNA sequences. The file example.ids contains 4 example model IDs, one on each line, reproduced here: D00210.001 # RBFOX1 (RNAcompete) D00120.001 # MBNL1 (RNAcompete) D00410.003 # GATA3 (SELEX) D00328.003 # CTCF (SELEX) The file example.seq contains 4 example sequences, which were chosen such that the nth sequence scores highly for the nth model. The file example.seq is reproduced here: AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU GAGGTTACGCGGCAAGATAA TACCACTAGGGGGCGCCACC To generate 16 predictions (4 models, 4 sequences), run the deepbind executable as follows: % deepbind example.ids < example.seq D00210.001 D00120.001 D00410.003 D00328.003 7.345649 -0.152710 -0.763340 -0.026180 -0.159393 3.663924 -0.196943 -0.026180 -0.143584 0.357632 5.885349 -0.026180 -0.161033 -0.081444 -0.379695 17.682623 To see details of each ID, use the --dump-info flag: % deepbind --dump-info example.ids ID Protein Type Species Family Class Experiment ... D00210.001 RBFOX1 RBP Homo sapiens RRM RNAcompete ... D00120.001 MBNL1 RBP Homo sapiens Znf RNAcompete ... D00410.003 GATA3 TF Homo sapiens GATA SELEX ... D00328.003 CTCF TF Homo sapiens znfC2H2 SELEX ...