Unable to detect viral sequences on scRNA sample from infected patient

[salvoc81]

First of all I wanted to thank all the researchers involved in the creation and maintenance of this tool.

I followed the two main notebooks describing how to detect viral sequence in Bulk and scRNA datasets.
I could mostly reproduce the results.

I then turned to a separate public dataset of patients infected with SarsCov2 and influenza.
Following are the samples in the study:
https://www.ncbi.nlm.nih.gov/Traces/study/?acc=SRP259912&o=acc_s%3Aa
and the paper
https://doi-org.kyoto-u.idm.oclc.org/10.1126/sciimmunol.abd1554

Unfortunately I could identify the viral sequences...
The highest value in the CSR matrix with count is 92.

I am not sure if I am doing something wrong.
The index was generated as described in the guide in the notebooks

For simplicity I will show the command used for a single sample from a patient with severe Covid infection.
ID: SRR11680221
kb count --num --verbose --cellranger -t 54 --aa -k 31 -x 10xv3 --parity single -i palmdb_homo_sapiens_dlist_dna_cdna.idx -g palmdb_clustered_t2g.txt --h5ad -o severe_covid SRR11680221_1.fastq SRR11680221_2.fastq

I am not sure if I am doing something wrong,
and I would greatly appreciate your assistance.

According to the manuscript the sequencing was done as follows:

• Chromium Single Cell 3′ Library & Gel Bead Kit v3 (10× Genomics)
• sequenced as a depth of approximately 50,000 reads per cell
• Sequencer: Nextseq 550 or Novaseq 6000

For reference I am also pasting the first sequence of R1 and R2 datasets:

SRR11680221_1.fastq
@SRR11680221.1 1 length=28
NGCCAGACAGCCGTTGCTCACTTTATTT
+SRR11680221.1 1 length=28
#FFFFFFFFFFFF:FFFFFFFFFFFFFF

SRR11680221_2.fastq
@SRR11680221.1 1 length=91
AATAAATGCAAGCACAAATCACAAATCTCTGATTTCGAGACCTGACTGAGTCACAGAGCAAGACCTTGTCTCTACAAAATATTTTTTAAAT
+SRR11680221.1 1 length=91
FFFFFFFF:FFFFFFFFFF:FFFFFF:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF

Thank you a lot in advance for your help.

If necessary I could provide logs, or the matrix file generated