Merging PC repo with main repo so I can see stuff on the laptop too

.vscode/settings.json

@@ -0,0 +1,5 @@
+{
+    "python.analysis.extraPaths": [
+        "./rosalind_data"
+    ]
+}

README.md

@@ -1,3 +1,3 @@
-# Welcome to my Homework Domain!
+# Domain Expansion: Python Homework Repository
 
 

rosalind_data/ascii.py

@@ -0,0 +1,31 @@
+# This is the attempt at making a ASCII art drawing script
+
+# Goal: Draw a 10 lines large triangle
+
+# First idea: Make a loop that first adds "/""\" characters without a space between them and after the second line start adding spaces
+
+# Maybe try a dictionary first?
+
+
+# triangle_sides_dictionary = {"right": "\\", "left": "/"}
+
+# print(triangle_sides_dictionary["left"],triangle_sides_dictionary["right"], sep= "")
+
+# pyramid_right = {"right1": "\\", "right2": "  ""\\", "right3": "____""\\"}
+# pyramid_left = {"left1": "  ""/", "left2": " ""/", "left3": "/"}
+
+
+# print(pyramid_left["left1"]+pyramid_right["right1"],pyramid_left["left2"]+pyramid_right["right2"],pyramid_left["left3"]+pyramid_right["right3"], sep= "\n")
+
+my_dict = {"a": 1, 
+           "b": 2, 
+           "c": 3, 
+           "d": 4, 
+           "e": 5}
+
+print(my_dict)
+
+
+
+
+

rosalind_data/ini5.txt

@@ -0,0 +1,40 @@
+`Twas brillig, and the slithy toves
+Some things in life are bad, they can really make you mad
+  Did gyre and gimble in the wabe:
+Other things just make you swear and curse
+All mimsy were the borogoves,
+When you're chewing on life's gristle, don't grumble give a whistle
+  And the mome raths outgrabe.
+This will help things turn out for the best
+"Beware the Jabberwock, my son!
+Always look on the bright side of life
+  The jaws that bite, the claws that catch!
+Always look on the right side of life
+Beware the Jubjub bird, and shun
+If life seems jolly rotten, there's something you've forgotten
+  The frumious Bandersnatch!"
+And that's to laugh and smile and dance and sing
+He took his vorpal sword in hand:
+When you're feeling in the dumps, don't be silly, chumps
+  Long time the manxome foe he sought --
+Just purse your lips and whistle, that's the thing
+So rested he by the Tumtum tree,
+So, always look on the bright side of death
+  And stood awhile in thought.
+Just before you draw your terminal breath
+And, as in uffish thought he stood,
+Life's a counterfeit and when you look at it
+  The Jabberwock, with eyes of flame,
+Life's a laugh and death's the joke, it's true
+Came whiffling through the tulgey wood,
+You see, it's all a show, keep them laughing as you go
+  And burbled as it came!
+Just remember the last laugh is on you
+One, two! One, two! And through and through
+Always look on the bright side of life
+  The vorpal blade went snicker-snack!
+And always look on the right side of life
+He left it dead, and with its head
+Always look on the bright side of life
+  He went galumphing back.
+And always look on the right side of life

rosalind_data/prot.py

@@ -0,0 +1,65 @@
+# PROT Exercise
+
+# Given: An RNA string "rosalind_prot" corresponding to a strand of mRNA (of lenght at most 10kbp)
+
+# Return: The protein string encoded by "rosalind_prot"
+
+# First, lets use the read_input function from the util list
+
+# Second, create dictionary including the RNA codon table
+
+# Third, figure out a way to read every 3 characters in "rosalind_prot", while checking the dictionary for the corresponding key, and then replacing it with the value
+
+# Fourth, save the new string with the values corresponding to their keys (or nucleotide triplets) in a new list "protein_string" and print it
+
+# Thoughts: I'd like to try and seperate the string after every 3rd step. There might be a way to do it with slicing maybe?
+# Findings Nr1: Ok so after some research online, I managed to get a loop together to slice the sequence into triplets, however, its not working with the read_input function?
+# When I use the read_input function, print(len(sample_stringtext)) gives me the number "1", however it should be 51! Why is that happening? Is there something wrong with how
+# the util file works? If this gets fixed, then I think I can continue with solving the next steps (hopefully)...
+
+
+# from util import read_input
+
+# sample_stringtext = read_input('./rosalind_prot.txt')
+
+codon_table_dict = {"UUU": "F", "CUU": "L", "AUU": "I","GUU": "V",
+"UUC": "F", "CUC": "L", "AUC": "I", "GUC": "V",
+"UUA": "L", "CUA": "L", "AUA": "I", "GUA": "V",
+"UUG": "L", "CUG": "L", "AUG": "M", "GUG": "V",
+"UCU": "S", "CCU": "P", "ACU": "T", "GCU": "A",
+"UCC": "S", "CCC": "P", "ACC": "T", "GCC": "A",
+"UCA": "S", "CCA": "P", "ACA": "T", "GCA": "A",
+"UCG": "S", "CCG": "P", "ACG": "T", "GCG": "A",
+"UAU": "Y", "CAU": "H", "AAU": "N", "GAU": "D",
+"UAC": "Y", "CAC": "H", "AAC": "N", "GAC": "D",
+"UAA": "Stop", "CAA": "Q", "AAA": "K", "GAA": "E",
+"UAG": "Stop", "CAG": "Q", "AAG": "K", "GAG": "E",
+"UGU": "C", "CGU": "R", "AGU": "S", "GGU": "G",
+"UGC": "C", "CGC": "R", "AGC": "S", "GGC": "G",
+"UGA": "Stop", "CGA": "R","AGA": "R", "GGA": "G",
+"UGG": "W", "CGG": "R","AGG": "R", "GGG": "G"}
+
+# print(codon_table_dict["AAA"])
+
+# print(sample_stringtext)
+
+# Note: using read_input from util is not working for some reason, the lenght for the sample_stringtext appears to be "1", which is not the case (it should be 51).
+
+# for prots in codon_table_dict:
+#     if prots == codon_table_dict["AUG"]:
+#         print(codon_table_dict.values)
+#     else:
+#         print("not found")
+
+# I tried it with defining a new variable with the example code from Rosalind, and this worked the way it should! It counted the lenght right, and it managed to slice it into triplets.
+
+sequence = "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"
+
+for i in range(0, len(sequence), 3):
+    codon = sequence[i:i+3]
+    if len(codon) == 3:
+        print(codon)
+
+
+
+

rosalind_data/rosalind_prot.txt

@@ -0,0 +1 @@
+AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA

rosalind_data/util.py

@@ -1,9 +1,9 @@
 # a library of utility functions for Rosalind exercises
 
 def read_input(filepath):
-    with open(filepath, "r") as infile:
-        lines=infile.readlines()
+    with open(filepath, 'r') as infile:
+        lines = infile.readlines()
         stripped = []
         for line in lines:
             stripped.append(line.strip())
-    return stripped
+    return stripped