Auxillary Fasta parser utils for working with fasta object.just Read and parse.
Install fastautil with npm:
$ npm install fastautilvar fastautil = require('fastautil');
fasta== new fastautil.Fasta();
var object = fasta.parse('>sequence1\n\
ATGCACGTCACGTCAGTACTCGTCAGTAC\n\
>sequence2\n\
CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC\n');
//=> {
// id:1,
// name: 'sequence1',
// sequence: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
// {
// name: 'sequence2',
// sequence: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }fasta.write(object);To contribute, clone this repo locally and commit your code on a separate branch.
Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:
$ npm testCheck the issues for ways to contribute.
Sahil Shetye <sahilshetye2606@gmail.com> @sahilshetye