-
Notifications
You must be signed in to change notification settings - Fork 1
Tutorial
This tutorial gives a beginner's guide.
Table of Contents
- Input data
- First running example
- Choosing the right substitution model
- New model selection
- Codon models
- Binary, morphological and SNP data
- Assessing branch supports with ultrafast bootstrap approximation
- Assessing branch supports with standard nonparametric bootstrap
- Assessing branch supports with single branch tests
- Utilizing multi-core CPUs
- Where to go from here?
Please first download and install the binary
for your platform . For the next steps, the folder containing your iqtree executable should be added to your PATH enviroment variable so that IQ-TREE can be invoked by simply entering iqtree at the command-line. Alternatively, you can also copy iqtree binary into your system search.
TIP: For quick overview of all supported options in IQ-TREE, run the command
iqtree -h.
IQ-TREE takes as input a multiple sequence alignment and will reconstruct an evolutionary tree that is best explained by the input data. The input alignment can be in various common formats. For example the PHYLIP format which may look like:
7 28
Frog AAATTTGGTCCTGTGATTCAGCAGTGAT
Turtle CTTCCACACCCCAGGACTCAGCAGTGAT
Bird CTACCACACCCCAGGACTCAGCAGTAAT
Human CTACCACACCCCAGGAAACAGCAGTGAT
Cow CTACCACACCCCAGGAAACAGCAGTGAC
Whale CTACCACGCCCCAGGACACAGCAGTGAT
Mouse CTACCACACCCCAGGACTCAGCAGTGAT
This tiny alignment contains 7 DNA sequences from several animals with the sequence length of 28 nucleotides. IQ-TREE also supports other file formats such as FASTA, NEXUS, CLUSTALW. The FASTA file for the above example may look like this:
>Frog
AAATTTGGTCCTGTGATTCAGCAGTGAT
>Turtle
CTTCCACACCCCAGGACTCAGCAGTGAT
>Bird
CTACCACACCCCAGGACTCAGCAGTAAT
>Human
CTACCACACCCCAGGAAACAGCAGTGAT
>Cow
CTACCACACCCCAGGAAACAGCAGTGAC
>Whale
CTACCACGCCCCAGGACACAGCAGTGAT
>Mouse
CTACCACACCCCAGGACTCAGCAGTGAT
TIP: If you have raw sequences, you need to first apply alignment programs like MAFFT or ClustalW to align the sequences, before feeding them into IQ-TREE.
From the download there is an example alignment called example.phy
in PHYLIP format. This example contains parts of the mitochondrial DNA sequences of several animals (Source: Phylogenetic Handbook).
You can now start to reconstruct a maximum-likelihood tree
from this alignment by entering (assuming that you are now in the same folder with example.phy):
iqtree -s example.phy
-s is the option to specify the name of the alignment file that is always required by
IQ-TREE to work. At the end of the run IQ-TREE will write several output files:
-
example.phy.iqtree: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below). -
example.phy.treefile: the ML tree in NEWICK format, which can be visualized by any supported tree viewer programs like FigTree or iTOL. -
example.phy.log: log file of the entire run (also printed on the screen). To report bugs, please send this log file and the original alignment file to the authors.
For this example data the resulting maximum-likelihood tree may look like this (extracted from .iqtree file):
NOTE: Tree is UNROOTED although outgroup taxon 'LngfishAu' is drawn at root
+--------------LngfishAu
|
| +--------------LngfishSA
+--------|
| +--------------LngfishAf
|
| +-------------------Frog
+------|
| +-----------------Turtle
| +-----|
| | | +-----------------------Sphenodon
| | | +--|
| | | | +--------------------------Lizard
| | +---|
| | | +---------------------Crocodile
| | +------|
| | +------------------Bird
+---------|
| +----------------Human
| +--|
| | | +--------Seal
| | +--|
| | | +-------Cow
| | +---|
| | +---------Whale
| +----|
| | | +------Mouse
| | +---------|
| | +--------Rat
+----------|
| +----------------Platypus
+---|
+-------------Opossum
This makes sense as the mammals (Human to Opossum) form a clade, whereas the reptiles (Turtle to Crocodile) and Bird form a separate sister clade. Here the tree is drawn at the outgroup Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an unrooted tree as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as LngfishAu is the first sequence occuring in the alignment.
Finally, the default prefix of all output files is the alignment file name. However, you can always
change the prefix using the -pre option, e.g.:
iqtree -s example.phy -pre myprefix
This prevents output files to be overwritten when you perform multiple analyses on the same alignment within the same folder.
IQ-TREE supports a wide range of substitution models for DNA, protein, codon, binary and morphological alignments. If the model is not specified, IQ-TREE will use the default model (
HKY for DNA, WAG for protein). In case you do not know which model is appropriate for your data, IQ-TREE can automatically determine the best-fit model
for your alignment using the -m TEST option. For example:
iqtree -s example.phy -m TEST
-m is the option to specify the model name to use during the analysis. TEST
is a key word telling IQ-TREE to perform the model test procedure and select the best-fit model. The remaining analysis
will be done using the selected model. More specifically, IQ-TREE computes the log-likelihoods
of the initial parsimony tree for many different models and the Akaike information criterion (AIC), corrected Akaike information criterion (AICc), and the Bayesian information criterion (BIC).
Then IQ-TREE chooses the model that minimizes the BIC score (you can also change to AIC or AICc by
adding the option -AIC or -AICc, respectively.
Here, IQ-TREE will write an additional file:
-
example.phy.model: log-likelihoods for all models tested.
If you now look at example.phy.iqtree you will see that IQ-TREE selected the model TIM2
with Invar+Gamma rate heterogeneity. So TIM2+I+G is the best-fit model
for this example data. Thus, for additional analyses you do not have to perform the model test again and can use the selected model as follows.
iqtree -s example.phy -m TIM2+I+G
Sometimes you only want to find the best-fit model without doing tree reconstruction, then run:
iqtree -s example.phy -m TESTONLY
Here, IQ-TREE will stop after finishing the model selection. Note that if the file *.model exists and is correct, IQ-TREE will reuse the computed log-likelihoods to speed up the model selection procedure.
The previous section described the "standard" model selection to automatically select the best-fit model for the data before performing tree reconstruction. This "standard" procedure includes four rate heterogeneity types: homogeneity, +I, +G and +I+G. However, there is no reason to believe that the evolutionary rates follow a Gamma distribution. Therefore, we have recently introduced the FreeRate (+R) heterogeneity (Yang, 1995) into IQ-TREE. The +R model generalizes the Gamma model by relaxing the "Gamma constraints", where the site rates and proportions are inferred independently from the data. Another advantage is that +R allows to automatically determine the number of rate categories, which is impossible with +G where the default of 4 categories is used. This can be important especially for phylogenomic data, where 4 categories may "underfit" the data.
Therefore, we recommend a new ModelFinder procedure that additionally considers +R rate heterogeneity. This can be invoked simply with e.g.:
iqtree -s example.phy -m MF
# for IQ-TREE version <= 1.5.3 use -m TESTNEWONLY
It will also automatically determine the optimal number of rate categories. By default, the maximum number of categories is 10 due to computational reasons. If the sequences of your alignment are long enough, then you can increase this upper limit with the cmax option:
iqtree -s example.phy -m MF -cmax 15
will test +R2 to +R15 instead of at most +R10.
To reduce computational burden, one can use the option -mset to restrict the testing procedure to a subset of base models instead of testing the entire set of all available models. For example, -mset WAG,LG will test only models like WAG+... or LG+.... Another useful option in this respect is -msub for AA data sets. With -msub nuclear only general AA models are included, whereas with -msub viral only AA models for viruses are included.
If you have enough computational resource, you can perform a thorough and more accurate analysis that invokes a full tree search for each model considered via the -mtree option:
iqtree -s example.phy -m MF -mtree
Finally, if you want to immediately perform tree reconstruction after model selection, then use -m MFP:
iqtree -s example.phy -m MFP
IQ-TREE supports a number of codon models. You need to input a protein-coding DNA alignment and specify codon data by option -st CODON (Otherwise, IQ-TREE applies DNA model because it detects that your alignment has DNA sequences):
iqtree -s coding_gene.phy -st CODON
If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character.
If you are not sure which model to use, simply add -m TEST, which also works for codon alignments:
iqtree -s coding_gene.phy -st CODON -m TEST
By default IQ-TREE uses the standard genetic code. If you want to change the genetic code, please refer to codon models guide.
IQ-TREE supports discrete morphological alignments by -st MORPH option:
iqtree -s morphology.phy -st MORPH
IQ-TREE implements to two morphological ML models: MK and ORDERED. Morphological data typically do not have constant (uninformative) sites. In such cases, you should apply ascertainment bias correction model by e.g.:
iqtree -s morphology.phy -st MORPH -m MK+ASC
You can again select the best-fit model with -m TEST (which also considers +G):
iqtree -s morphology.phy -st MORPH -m TEST
For SNP data (DNA) that typically do not contain constant sites, you can explicitly tell the model to include ascertainment bias correction:
iqtree -s SNP_data.phy -m GTR+ASC
You can explicitly tell model testing to only include +ASC model with:
iqtree -s SNP_data.phy -m TEST+ASC
To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) (Minh et al., 2013) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. To run UFBoot, use the option -bb:
iqtree -s example.phy -m TIM2+I+G -bb 1000
-bb specifies the number of bootstrap replicates where 1000
is the minimum number recommended. The section MAXIMUM LIKELIHOOD TREE in example.phy.iqtree shows a textual representation of the maximum likelihood tree with branch support values in percentage. The NEWICK format of the tree is printed to the file example.phy.treefile. In addition, IQ-TREE writes the following files:
-
example.phy.contree: the consensus tree with assigned branch supports where branch lengths are optimized on the original alignment. -
example.phy.splits: support values in percentage for all splits (bipartitions), computed as the occurence frequencies in the bootstrap trees. This file is in "star-dot" format. -
example.phy.splits.nex: has the same information asexample.phy.splitsbut in NEXUS format, which can be viewed with the program SplitsTree.
TIP: UFBoot support values have a different interpretation to the standard bootstrap. Refer to FAQ: UFBoot support values interpretation for more information.
The standard nonparametric bootstrap is invoked by the -b option:
iqtree -s example.phy -m TIM2+I+G -b 100
-b specifies the number of bootstrap replicates where 100
is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure.
IQ-TREE provides an implementation of the SH-like approximate likelihood ratio test (Guindon et al., 2010). To perform this test, run:
iqtree -s example.phy -m TIM2+I+G -alrt 1000
-alrt specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended.
IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996). See single branch tests for more details.
You can also perform both SH-aLRT and the ultrafast bootstrap within one single run:
iqtree -s example.phy -m TIM2+I+G -alrt 1000 -bb 1000
The branches of the resulting .treefile will be assigned with both SH-aLRT and UFBoot support values, which are readable by any tree viewer program like FigTree, Dendroscope or ETE. You can also look at the textual tree figure in .iqtree file:
NOTE: Tree is UNROOTED although outgroup taxon 'LngfishAu' is drawn at root
Numbers in parentheses are SH-aLRT support (%) / ultrafast bootstrap support (%)
+-------------LngfishAu
|
| +--------------LngfishSA
+-------| (100/100)
| +------------LngfishAf
|
| +--------------------Frog
+------| (99.8/100)
| +-----------------Turtle
| +--| (85/72)
| | | +------------------------Crocodile
| | +----| (96.5/97)
| | +------------------Bird
| +--| (39/51)
| | +---------------------------Sphenodon
| +-----| (98.2/99)
| | +-------------------------------Lizard
+---------| (100/100)
| +--------------Human
| +--| (92.3/93)
| | | +------Seal
| | +--| (68.3/75)
| | | +-----Cow
| | +--| (99.7/100)
| | +-------Whale
| +----| (99.1/100)
| | | +---Mouse
| | +---------| (100/100)
| | +------Rat
+-----------| (100/100)
| +--------------Platypus
+--| (93/98)
+-----------Opossum
From this figure, the branching patterns within reptiles are poorly supported (e.g. Sphenodon with SH-aLRT: 39%, UFBoot: 51% and Turtle with SH-aLRT: 85%, UFBoot: 72%) as well as the phylogenetic position of Seal within mammals (SH-aLRT: 68.3%, UFBoot: 75%). Other branches appear to be well supported.
A specialized version of IQ-TREE (iqtree-omp) can utilize multiple CPU cores to speed up the analysis.
To obtain this version please refer to the quick starting guide. A complement option -nt allows specifying the number of CPU cores to use. For example:
iqtree-omp -s example.phy -m TIM2+I+G -nt 2
Here, IQ-TREE will use 2 CPU cores to perform the analysis.
Note that the parallel efficiency is only good for long alignments. A good practice is to use -nt AUTO to determine the best number of cores:
iqtree-omp -s example.phy -m TIM2+I+G -nt AUTO
Then while running IQ-TREE may print something like this on to the screen:
Measuring multi-threading efficiency up to 8 CPU cores
Threads: 1 / Time: 8.001 sec / Speedup: 1.000 / Efficiency: 100% / LogL: -22217
Threads: 2 / Time: 4.346 sec / Speedup: 1.841 / Efficiency: 92% / LogL: -22217
Threads: 3 / Time: 3.381 sec / Speedup: 2.367 / Efficiency: 79% / LogL: -22217
Threads: 4 / Time: 4.385 sec / Speedup: 1.825 / Efficiency: 46% / LogL: -22217
BEST NUMBER OF THREADS: 3
Therefore, I would only use 3 cores for this example data. For later analysis with your same data set, you can stick to the determined number.
Once confident enough you can go on with a more advanced tutorial, which covers topics like phylogenomic (multi-gene) analyses using partition models or mixture models.
Copyright (c) 2010-2022 IQ-TREE development team.
- First example
- Model selection
- New model selection
- Codon models
- Binary, Morphological, SNPs
- Ultrafast bootstrap
- Nonparametric bootstrap
- Single branch tests
- Partitioned analysis
- Partitioning with mixed data
- Partition scheme selection
- Bootstrapping partition model
- Utilizing multi-core CPUs
- Tree topology tests
- User-defined models
- Consensus construction and bootstrap value assignment
- Computing Robinson-Foulds distance
- Generating random trees
- Estimating amino acid substitution models
- DNA models
- Protein models
- 3Di and TEA models
- Codon models
- Binary, morphological models
- Ascertainment bias correction
- Rate heterogeneity
- Counts files
- First running example
- Substitution models
- Virtual population size
- Sampling method
- Bootstrap branch support
- Interpretation of branch lengths