DNA Translation and Motif Finder

This project provides two interfaces:

1. A CLI tool for translating DNA and finding motifs.
2. A web app (FastAPI + HTML/JS) for browser-based analysis.

Features

• DNA normalization/validation (A, C, G, T, N)
• Translation in frame 1, 2, or 3
• Reverse-complement option
• Optional stop-at-first-stop behavior
• Motif search with overlapping matches
• IUPAC motif ambiguity support (e.g., AAR, GGN)

CLI usage

python3 dna_translation_motif_finder.py "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG" --motif "GGN"

CLI options

• --frame {1,2,3}: Select translation reading frame (default 1)
• --reverse-complement: Analyze reverse complement instead of input sequence
• --stop-at-stop: Stop translation at first stop codon
• --motif MOTIF: Find motif and print all match positions (0-based)

If you run from Python IDLE with no command-line arguments, an interactive menu collects:

• DNA sequence
• reading frame
• reverse-complement choice
• stop-at-stop choice
• optional motif

Website usage

1) Install dependencies

python3 -m pip install -r requirements.txt

2) Run the web app

uvicorn app:app --reload

3) Open in browser

Visit: http://127.0.0.1:8000

Use the form to submit sequence/options and view translation + motif results.

API endpoint

POST /api/analyze

Example JSON payload:

{
  "sequence": "ATGAAATGA",
  "frame": 1,
  "reverse_complement": false,
  "stop_at_stop": true,
  "motif": "AAR"
}

Example response fields:

• dna
• protein
• motif_positions
• plus selected option flags