Repository navigation
Input formats
A FASTA file is a standard formatted file for storing nucleotide sequence data. HomoplasyFinder requires the input FASTA file to be in the following format:
3 20
>Sequence1
TCTCATACATACATACATAC
>Sequence2
TCTCATACATACATACATAC
>Sequence3
TCTCATACATACATACATAC
The first line is optional and it contains the number of sequences and the number of sites stored in the file. The lines that follow contains the name and nucleotides associated with each sequence. Each sequence name must be preceded with ">" and must be unique. The nucleotides can be split across multiple lines.
A CSV (Comma Separated Values) file is a standard formatted file for storing a table. Here we are using a CSV file to record the presence/absence of different INDELs (Insertions or Deletions) in an alignment. HomoplasyFinder requires the input CSV file to be in the following format:
start,end,isolateA,isolateB,isolateC
34802,35208,0,1,0
39068,39069,0,0,1
The first two columns detail the start and end of each INDEL region. Each column that follows relates to a single isolate (the column name should match the tip labels in the Newick tree file described below). This column records whether each region (represented as a row) is present (1) or absent (0) in the given isolate.
The Newick file is a standard formatted file for storing a phylogenetic tree. HomoplasyFinder requires a file containing only a single Newick formatted phylogenetic tree. Importantly the tip names in the Newick phylogenetic tree must exactly match those in the input FASTA or presence/absence file. Branch lengths aren't required to be present. The Newick formatted phylogeny can be split across multiple lines, and must end with a ";". HomoplasyFinder will work on a rooted phylogeny. A newick format always contains a root, which will be added arbitrarily on an unrooted phylogeny.