Congrats, you've made it to the repo for Teselagen's Open Source Vector Editor Component
- Built With React & Redux
- Built for easy extensibility + embed-ibility
Issue Tracking Board: https://waffle.io/TeselaGen/openVectorEditor
- Issue Tracking Board: https://waffle.io/TeselaGen/openVectorEditor
- Demo: http://teselagen.github.io/openVectorEditor/
- Table of Contents
- Upgrade Instructions for Major and Minor Versions
- Using this module in React
- Using this module outside of react apps (Universal):
- editorProps
- editorState
- Data Model
- Alignments
- Development:
This repo follows semantic versioning (major/minor/patche)
The commit log can be seen here: https://github.com/TeselaGen/openVectorEditor/commits/master
Upgrade instructions for any major or minor change can be found here: Upgrade instructions
yarn add install-peerdeps open-vector-editor
Add peer-dependencies:
install-peerdeps open-vector-editor --dev --only-peers
Require the following components like:
import {Editor, RowView} from "open-vector-editor
The <Editor {...editorProps}/> component gives you a full blown editor.
It takes in a list of editorProps as detailed below.
This gives you just the circular/plasmid map view. Either redux connected or unconnected (non-interactive)
This gives you just the linear map view. Either redux connected or unconnected (non-interactive)
This gives you just the detailed view of the sequence rows. Either redux connected or unconnected (non-interactive)
A component used for viewing enzymes
The universal build can be used in any app with or without react. It corresponds to using the component in the React version. You will be able to customize the Editor just like in the react build, but you will not be able to use the individual components like or . For that you'll need to use React.
npm install open-vector-editor
then add the links
<link rel="stylesheet" type="text/css" href="your-path-to-node-modules/open-vector-editor/umd/main.css">
<script type="text/javascript" src="your-path-to-node-modules/open-vector-editor/umd/open-vector-editor.js"></script><link rel="stylesheet" type="text/css" href="https://unpkg.com/open-vector-editor/umd/main.css">
<script type="text/javascript" src="https://unpkg.com/open-vector-editor/umd/open-vector-editor.js"></script><script>
const editor = window.createVectorEditor(yourDomNodeHere, editorProps);
editor.updateEditor(editorState);
</script>Demo (Universal): http://teselagen.github.io/openVectorEditor/
These props consist of hooks and editor config options that can be passed like so: <Editor {...editorProps}/> or as seen above like window.createVectorEditor(yourDomNodeHere, editorProps);
{
shouldAutosave: true, //by default the editor does not autosave, setting this to true will trigger the onSave callback after any change to the sequenceData
onSave: function(event, sequenceDataToSave, editorState, onSuccessCallback) {
console.info("event:", event);
console.info("sequenceData:", sequenceDataToSave);
console.info("editorState:", editorState);
// To disable the save button after successful saving
// either call the onSuccessCallback or return a successful promise :)
onSuccessCallback()
//or
// return myPromiseBasedApiCall()
},
onCopy: function(event, copiedSequenceData, editorState) {
//the copiedSequenceData is the subset of the sequence that has been copied in the teselagen sequence format
console.info("event:", event);
console.info("sequenceData:", copiedSequenceData);
console.info("editorState:", editorState);
const clipboardData = event.clipboardData;
clipboardData.setData("text/plain", copiedSequenceData.sequence);
clipboardData.setData(
"application/json",
JSON.stringify(copiedSequenceData)
);
event.preventDefault();
//in onPaste in your app you can do:
// e.clipboardData.getData('application/json')
},
onPaste: function(event, editorState) {
//the onPaste here must return sequenceData in the teselagen data format
const clipboardData = event.clipboardData;
let jsonData = clipboardData.getData("application/json")
if (jsonData) {
jsonData = JSON.parse(jsonData)
if (jsonData.isJbeiSeq) {
jsonData = convertJbeiToTeselagen(jsonData)
}
}
const sequenceData = jsonData || {sequence: clipboardData.getData("text/plain")}
return sequenceData
},
//regular click overrides, eg:
featureClicked: ({annotation, event}) => {
//do something here :)
}
// orf/primer/translation/cutsite/translationDouble/deletionLayer/replacementLayer/feature/part/searchLayer xxxxClicked can also be overridden
rightClickOverrides: { //override what happens when a given feature/part/primer/translation/orf/cutsite/selectionLayer/lineageLine gets right clicked
//the general format is xxxxRightClicked eg:
selectionLayerRightClicked: (items, {annotation}, props) => {
return [...items, {
//props here get passed directly to blueprintjs MenuItems
text: "Create Part",
onClick: () => console.info('hey!≈')
}]
}
},
PropertiesProps: {
// the list of tabs shown in the Properties panel
propertiesList: [
"general",
"features",
"parts",
"primers",
"translations",
"cutsites",
"orfs",
"genbank"
]
},
ToolBarProps: {
toolList: [
"saveTool",
//you can override a tool like so:
{name: "downloadTool", Dropdown: () => {
return "Hey!"
}},
"importTool",
"undoTool",
"redoTool",
"cutsiteTool",
"featureTool",
"alignmentTool",
// "oligoTool",
"orfTool",
// "viewTool",
"editTool",
"findTool",
"visibilityTool"
// "propertiesTool"
]
}
onDigestSave: () => {} //tnr: NOT YET IMPLEMENTED
}These are the options to the updateEditor() action (the most generic redux action we have)) and will cause the editor state stored in redux to be updated. Only the subset of options that are passed will be updated.
{
//note, sequence data passed here will be coerced to fit the Teselagen data model
sequenceData: { Open Vector Editor data model
sequence: "atagatagagaggcccg",
features: [
{
color: "#b3b3b3", //you can override the default color for each individual feature if you want
type: "misc_feature",
start: 0, //start and end are 0-based inclusive for all annotations
end: 10,
id: 'yourUniqueID',
forward: true //ie true=positive strand false=negative strange
}
],
parts: []
},
annotationVisibility: {
features: false
},
panelsShown: [
[
{
id: "sequence",
name: "Sequence Map",
active: true
}
],
[
{
id: "circular",
name: "Plasmid",
active: true
},
{
id: "rail",
name: "Linear Map",
active: false
},
{
id: "properties",
name: "Properties",
active: false
}
]
],
caretPosition: 10,
...additional editor props can be passed here [Example Editor State](./editorStateExample.js)
}The data model can be interactively inspected by installing the redux devtools for your browser: devtools Here is the top level editor state: Example Editor State
Integrating your own alignment data (only necessary if not using the built in alignment creation tool)
Add a panel to the panelsShown prop like so:
window.createAlignmentView(this.node, {
id: "jbeiAlignment1", //give your alignment a unique id
////optional! Use if you want a pairwise alignment:
pairwiseAlignments: [ // this is an array of [referenceSequence, alignedSequence]
[
{ //reference sequence must come first!
sequenceData: {
id: "FWER1231", //every sequenceData and alignmentData should have a unique id
name: "GFPuv58",
sequence: "ttgagggg",
features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}]
},
alignmentData: {
sequence: "ttgag--ggg--" //this length should be the same as the below alignmentData length!
}
},{ //aligned sequence must come second!
sequenceData: {
name: "GFPuv58",
sequence: "gagccgggtt"
},
alignmentData: {
sequence: "--gagccgggtt" //this length should be the same as the above alignmentData length!
}
}
]
[
{Alignment Track Data Here}, //reference sequence track (see Data Model below for specs)
{Alignment Track Data Here}, //aligned sequence track (see Data Model below for specs)
],
[
{Alignment Track Data Here}, //see Data Model below for specs
{Alignment Track Data Here},
],
]
////optional! Use if you want a multi-seq alignment:
alignmentTracks: [
{Alignment Track Data Here}, //see Data Model below for specs
{Alignment Track Data Here},
{Alignment Track Data Here},
],
//additional view options:
"alignmentAnnotationVisibility": {
"features": true,
"yellowAxis": false,
"translations": false,
"parts": true,
"orfs": true,
"orfTranslations": false,
"axis": true,
"cutsites": false,
"primers": true,
"reverseSequence": false,
"lineageLines": true,
"axisNumbers": true
},
"alignmentAnnotationLabelVisibility": {
"features": true,
"parts": true,
"cutsites": false
},
});Note: alignmentData.sequence is assumed to be the same length for EVERY track within an alignment run or a pairwise alignment sub-alignment!
alignmentData can contain "-" characters, whereas sequenceData should not. Sequence Data is the "raw" data of the sequence being aligned with features/parts/etc.
{
//JBEI sequence 'GFPuv58'
// chromatogramData: ab1ParsedGFPuv58,
sequenceData: {
id: "2",
name: "GFPuv58",
sequence:
"GTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTT"
},
alignmentData: {
id: "2",
sequence:
"GTTCAA--TGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACA---GGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATAC--CCTTGTTAATCGTATCGAGTT--"
}
}"chromatogramData": { //only if parsing in an ab1 file
"aTrace": [], //same as cTrace but for a
"tTrace": [], //same as cTrace but for t
"gTrace": [], //same as cTrace but for g
"cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
"basePos": [33, 46, 55,], //x position of the bases (can be unevenly spaced)
"baseCalls": ["A","T", ...etc],
"qualNums": [],
},
Node.js >= v4 must be installed.
yarn
yarn start