Skip to content
This repository

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
branch: master

Fetching latest commit…

Cannot retrieve the latest commit at this time

README.md

View: the blossom of a genome assembly

About

View is a plugin for the genomer tool for genome projects. This plugin can be used to generate the files required to upload a genome project. The files generated includes sequence and annotation files. Each of the possible file formats is documented with a manual page.

Usage

The following examples are taken from the Pseudomonas fluorescens R124 genome project. These examples can be run by downloading this project and running bundle install.

The following command can be used to generate a fasta file with associated metadata:

genomer view fasta                                 \
  --identifier='PRJNA68653'                        \
  --organism='Pseudomonas fluorescens'             \
  --strain='R124'                                  \
  --gcode='11'                                     \
  --topology='circular'                            \
  --isolation-source='Orthoquartzite Cave Surface' \
  --collection-date='17-Oct-2007'                  \
  --completeness='Complete'                        \

>PRJNA68653 [organism=Pseudomonas fluorescens] [strain=R124] [gcode=11] ...
TGTTACCTGGTTCGTCCACAACGGGCCGGAATGGCCCCCGTTTTAAGAGACCGGGGATTCTAGAGAAAGC
AAGCCTTCAGGTCAATTTCCAACCAACGTTTCCTTATAAATAGATATCTGGAGCATCCAGAACCAAGACC
TTGCCTGCCAAACATAAAAATAAAGAAGGGAATTATTTAAAGCTTTTCTGTAAAGCTTATAAAAGCTAGG
GCGACAGTCTCTGTGGATAACCATGTTCAGCCCTTGTCTGGCTTGATGTACAGAGAATGACAACTACAGT
GGAAAACCGTGGTCAGCCTGTGCTGCGCTGTCGGATAACCTGTGTGTGGAACCGTCAGTTATCCACAGGC
AGGTTATCCACCGAGTTCCACCCCCAGTTGTCCAGTGCCCTCAGAGGCGGTTATCCACAGAGCTTATTCA
CACACCGTTGGTCGCCTTTTTACCGGTTAACGCATTGATTAATCATGGTCACCACACAACCTGCATGTGG
...

The following can be used to generate an annotation table suitable for submission to GenBank using tbl2asn.

genomer view table                                        \
  --identifier=PRJNA68653                         \
  --reset_locus_numbering=52                      \
  --prefix='I1A_'                                 \
  --generate_encoded_features='gnl|BartonUAkron|' \

>Feature    PRJNA68653  annotation_table
562 2076    gene
      locus_tag I1A_000052
      gene  dnaA
562 2076    CDS
      protein_id    gnl|BartonUAkron|I1A_000052
      product   DnaA
      function  chromosomal replication initiator protein
2116    3219    gene
      locus_tag I1A_000053
2116    3219    CDS
      protein_id    gnl|BartonUAkron|I1A_000053
      product   DNA polymerase III, beta subunit
...

Installation

Add this line to your genomer projects's Gemfile:

gem 'genomer-plugin-view'

And then execute in the project directory:

$ bundle

Run the help command and the summary plugin should be available:

$ genomer help
$ genomer man view

Copyright

Genomer copyright (c) 2010 by Michael Barton. Genomer is licensed under the MIT license. See LICENSE.txt for further details. The Star of Bethlehem image is used under a Creative Commons Generic 2.0 Licence. The original can be found on flickr.

Something went wrong with that request. Please try again.