Skip to content
Ivory Blakley edited this page Mar 12, 2019 · 5 revisions

Q: If biolockj indicates that my pipeline started successfully, but the pipeline root directory is not created, how do I debug the root cause of the failure?


A: Generally, errors are output to the pipeline log file and documented in the notification email, but invalid configuration settings may cause a fatal error to occur before the pipeline directory is created. In this scenario, look in your $HOME directory for a file name that starts with "biolockj_FATAL_ERROR_".

  • Verify you are running Java 1.8+

      java -version
    
  • Look in the error message found in $HOME/biolockj_FATAL_ERROR_* for a reference to one of your Config file parameters, the most common culprit is:

    • pipeline.defaultProps
    • $BLJ_PROJ misconfigured in /script/blj_config

Q: How should I configure input properties for a demultiplexed dataset?


A: Name the sequence files using the Sample IDs listed in your metadata file. Sequence file names containing a prefix or suffix (in addition the Sample ID) can be used as long as there is a unique character string that can be used to identify the boundary between the Sample ID and its prefix or suffix. These values can be set via the input.trimPrefix & input.trimSuffix properties.

  1. Set input.trimPrefix to a character string that precedes the sample ID for all samples
  2. Set input.trimSuffix to a character string that comes after the sample ID for all samples

If a single prefix or suffix identifier cannot be used for all samples, the file names must be updated so that a universal prefix or suffix identifier can be used.

Example

Sample IDs = mbs1, mbs2, mbs3, mbs4

Example File names

  • gut_mbs1.fq.gz
  • gut_mbs2.fq.gz
  • oral_mbs3.fq
  • oral_mbs4.fq

Config Properties

  • input.trimPrefix=_
  • input.trimSuffix=.fq

All characters before (and including) the 1st "_" in the file name are trimmed

All characters after (and including) the 1st ".fq" in the file name are trimmed

BioLockJ automatically trims extensions ".fasta" and ".fastq" as if configured in input.trimSuffix.


Q: How do I configure my pipeline for multiplexed data?


A: BioLockJ automatically adds the Demultiplexer as the 2nd module - after ImportMetadata - when processing multiplexed data. The Demultiplexer requires that the sequence headers contain either the Sample ID or an identifying barcode. Optionally, the barcode can be contained in the sequence itself. If your data does not conform to one of the following scenarios you will need to pre-process your sequence data to conform to a valid format.

If samples are not identified by sample ID in the sequence headers:

  1. Set demux.strategy=id_in_header
  2. Set input.trimPrefix to a character string that precedes the sample ID for all samples.
  3. Set input.trimSuffix to a character string that comes after the sample ID for all samples.

Sample IDs = mbs1, mbs2, mbs3, mbs4

Scenario 1: Your multiplexed files include Sample IDs in the fastq sequence headers

@mbs1_134_M01825:384:000000000-BCYPK:1:2106:23543:1336 1:N:0
@mbs2_12_M02825:384:000000000-BCYPK:1:1322:23543:1336 1:N:0
@mbs3_551_M03825:384:000000000-BCYPK:1:1123:23543:1336 1:N:0
@mbs4_1234_M04825:384:000000000-BCYPK:1:9872:23543:1336 1:N:0

Required Config

  • input.trimPrefix=@
  • input.trimSuffix=_

All characters before (and including) the 1st "@" in the sequence header are trimmed

All characters after (and including) the 1st "_" in the sequence header are trimmed

If samples are identified by barcode (in the header or sequence):

  1. Set demux.strategy=barcode_in_header or demux.strategy=barcode_in_seq
  2. Set metadata.filePath to metadata file path.
  3. Set metadata.barcodeColumn to the barcode column name.
  4. If the metadata barcodes are listed as reverse compliments, set demux.barcodeUseReverseCompliment=Y.

The metadata file must be prepared by adding a unique sequence barcode in the metadata.barcodeColumn column. This information is often available in a mapping file provided by the sequencing center that produced the raw data.

Metadata file

ID BarcodeColumn
mbs1 GAGGCATGACTGGATA
mbs2 NAGGCATATTTGCACA
mbs3 GACCCATGACTGCATA
mbs4 TACCCAGCACCGCTTA

Scenario 2: Your multiplexed files include a barcode in the headers

@M01825:384:000000000-BCYPK:1:2106:23543:1336 1:N:0:GAGGCATGACTGGATA
@M01825:384:000000000-BCYPK:1:1322:23543:1336 1:N:0:NAGGCATATTTGCACA
@M01825:384:000000000-BCYPK:1:1123:23543:1336 1:N:0:GACCCATGACTGCATA
@M01825:384:000000000-BCYPK:1:9872:23543:1336 1:N:0:TACCCAGCACCGCTTA 

Required Config

  • demux.strategy=barcode_in_header
  • metadata.barcodeColumn=BarcodeColumn
  • metadata.filePath=

Scenario 3: Your multiplexed files include a barcode in the sequences

>M01825:384:000000000-BCYPK:1:2106:23543:1336 1:N:0:
    GAGGCATGACTGGATATATACATACTGAGGCATGACTACTTACTATAAGGCTTACTGACTGGTTACTGACTGGGAGGCATGACTACTTACTATAA
>M01825:384:000000000-BCYPK:1:1322:23543:1336 1:N:0:
    CAGGCATATTTGCACACTAGAGGCAAGTTACTGACTGGATATACTGAGGCATGGGAGGCATGACTCTATAAGGCTTACTGACTGGTTACTGACTG
>M01825:384:000000000-BCYPK:1:1123:23543:1336 1:N:0: CCATGAGACCTGCATA
    CCATGAGACCTGCATACACTGTGGGAGGCATGACTCACTATAAACTACTACTGACTGGATATACTGAGGCATACTGACTGGTTACTTATAAGGCT
>M01825:384:000000000-BCYPK:1:9872:23543:1336 1:N:0:TACCCAGCACCGCTTA 
    TACCCAGCACCGCTTCCTTGACTTGGGAGGCATGACTCACTATAAACTACTACTGACTGGATATACTGAGGCATACTGACTGGTTACTTATAAGG

Clone this wiki locally