Skip to content

Repository files navigation

The eidolon project

Formerly rusty-neat / rneat — renamed to eidolon in v2.0.0. Same tool, same NEAT lineage; the rneat command still works as a deprecated alias for one transition release. See CHANGELOG.md.

Upgrading from 2.0.0 → 3.0.0? The names of emitted output tokens changed. See Upgrading from 2.0.0 below — read it if you have any script that parses eidolon VCFs or FASTQ/BAM read names.

Welcome to eidolon, a Rust port of NEAT (https://github.com/ncsa/neat), a genetic simulation program that creates fastq that appear to be from sequencers, carry the same statistical properties as your data, and generate a golden bam and fastq that gives you ideal alignments and what variants were inserted. In addition, eidolon generates "noise" in the form of sequencing errors as it is writing out files. These features can help you hone in your alignment and variant calling software to your data. Training models on your data will allow eidolon to faithfully reproduce the statistical properties of your dataset.

We have spent some dedicated time toward gearing the current version of eidolon to simulate cancer genetics, including adding structural variant simulations (CNV, BND, SVs, and others), and creating a wrapper that simulates purity levels and then stitches the results back together. We've geared this software with an aim at keeping memory usage as low and CPU time as short as possible. Let us know your real world experience by creating a Feedback issue, if you have something that's not quite a bug, or have a positive experience to share. As always, let us know if you find a bug and give as many details as you can to help us troubleshoot.

eidolon trains reusable models from your own data (mutation, sequencing-error, fragment-length, GC-bias, and BAM/alignment models), outputs a golden BAM with ideal alignments alongside the FASTQ and truth VCF, accepts a BED to target read creation to regions, and can read custom variants from an input VCF — including per-variant allele frequencies, to reproduce a continuous AF spectrum for pooled or somatic data. More recent releases add native tumor/normal simulation (eidolon gen-cancer-reads), structural variants and copy number, per-tissue somatic models, and trinucleotide-context-aware SNP placement so context-specific mutational signatures reproduce. A file-streaming writer keeps disk I/O and footprint low. See CHANGELOG.md for the full release history, and please open a Feedback issue with your real-world experience.

Find us on Zenodo: DOI

Cancer simulation

eidolon simulates tumor / normal sequencing data end-to-end. The eidolon gen-cancer-reads -c <config.yml> subcommand runs two gen-reads passes — one normal-genotype, one tumor — over the same reference and merges them at a configurable purity into a single "tumor biopsy" FASTQ that downstream somatic callers (Mutect2, Strelka, Manta, …) consume directly, plus an origin-tagged truth VCF (INFO/EIDOLON_ORIGIN ∈ {germline, somatic, shared}) for scoring. It also generates the foundational structural-variant types cancer SVs depend on — <BND> translocations, <INV> inversions, and de novo <INS> — and ships bundled pan-cancer and per-tissue (BRCA / skin / lung) models plus Docker-based benchmark pipelines.

See docs/cancer_howto.md for a copy-paste guide with worked examples, output reference, benchmarking, and model training. Design rationale and calibration caveats live in docs/cancer_simulator.md.

How eidolon compares to NEAT

eidolon is a Rust port of NEAT that tracks the NEAT feature set while adding a native cancer workflow, a low and flat memory footprint, and reproducible output. The table below compares the original Python 2 NEAT (the 2.x "genReads" line), the current Python 3 NEAT 4.x, and eidolon.

NEAT 2.x (genReads) NEAT 4.x eidolon
Latest version 2.1 4.5.3 3.0.0
Language Python 2 Python 3 Rust
FASTQ reads (single / paired)
Golden BAM + VCF truth set
SNPs + indels
Structural variants Input VCF only (no native SV) Native: inversions, translocations, duplications Native: BND, INV, INS, CNV
Native tumor / normal cancer workflow gen-cancer-reads (purity mix + origin-tagged truth)
Cancer / per-tissue models ✅ pan-cancer + BRCA / skin / lung (COSMIC / PCAWG)
Empirical mutation model (trinucleotide)
Sequencing error model
Fragment-length + GC-bias models ✅ (incl. one-pass gen-bam-models)
BED targeting / VCF variant insertion
Continuous per-variant allele fraction ❌ (genotype {0.5, 1.0}) ❌ (genotype {0.5, 1.0}) ✅ input-VCF AF/AD → matched AF spectrum (pooled / somatic)
Parallelism Manual job sharding (--job) Multiprocessing (--threads): genome split into ~8 chunks/thread, then stitched Multithreading (rayon)
VCF comparison tooling Bundled scripts compare-vcfs compare-vcfs
I/O / memory Temp files Temp files Streaming writes, low-memory focus
Distribution GitHub source GitHub / PyPI GitHub + binaries; Bioconda (conda install -c bioconda eidolon)

Citations. NEAT: Stephens et al. (2016), PLOS ONE 11(11):e0167047, doi:10.1371/journal.pone.0167047; and Allen et al. (2026), Journal of Open Source Software 11(121):9056, doi:10.21105/joss.09056. eidolon: doi:10.5281/zenodo.20100558.

Where eidolon fits. NEAT 4.x is a capable, actively developed simulator, and the two tools share most of their core feature set. eidolon is the right choice when you want:

  • Cancer simulation — a native tumor/normal workflow (gen-cancer-reads) with configurable purity and an origin-tagged truth VCF, plus CNVs and per-tissue cancer models. This is eidolon-only.
  • Low, flat memory — streaming FASTQ writes keep peak RSS small and roughly constant across genome size and thread count, which matters on shared HPC allocations.
  • Reproducibility — the same seed yields byte-identical FASTQ regardless of the thread count.
  • Easy deployment — a single self-contained binary with no Python environment to manage, installable via Bioconda (conda install -c bioconda eidolon).

Versioning and the public API

As of v3.0.0, eidolon follows Semantic Versioning 2.0.0: a MAJOR bump means something you may depend on changed incompatibly, a MINOR bump adds functionality compatibly, and a PATCH bump is fixes only. Releases before v3.0.0 were versioned less strictly — notably v1.11.0 and v1.12.0 changed the FASTQ read-name format in minor bumps.

SemVer requires a project to say what its public API is. For eidolon:

Public API — a change here means a MAJOR bump:

  • Names and semantics of emitted VCF INFO tags, the VCF sample-column name, and the FILTER / FORMAT fields eidolon writes
  • FASTQ/BAM read-name (QNAME) format — the EIDOLON_generated_ / EIDOLON_chimeric_ prefixes and the positional fields encoded after them
  • CLI subcommand names, flags, and configuration-YAML keys
  • Model-file compatibility (a model built by one version staying readable by the next)

Not public API — may change in a MINOR or PATCH release:

  • The eidolon-core Rust library surface; it exists to serve the binary
  • Log output, progress reporting, and human-readable messages
  • The exact simulated content for a given seed — reads are a random draw, so sampler and model changes legitimately alter output while preserving the format

If you parse eidolon's output, the first list is what you are relying on, and a major version bump is your signal to check this file before upgrading.

Upgrading from 2.0.0

v3.0.0 renamed the tokens eidolon emits. There is no behavior change — the same reads and variants are produced — but anything that parses eidolon output needs attention. In-tree consumers were all migrated; your own scripts were not.

Surface v2.0.0 and earlier v3.0.0+ Migration
VCF INFO tags NEAT_ORIGIN, NEAT_PROVENANCE, NEAT_REASON, NEAT_CCF, NEAT_VAF EIDOLON_* converter provided
VCF sample column NEAT_simulated_sample EIDOLON_simulated_sample converter provided
FASTQ read names @RNEAT_generated_*, RNEAT_chimeric_* @EIDOLON_generated_*, EIDOLON_chimeric_* not converted — see below
BAM read names (QNAME) RNEAT_generated_* EIDOLON_generated_* not converted — see below

VCFs — convert them

tools/migrate_legacy_tokens.sh old_truth.vcf.gz new_truth.vcf.gz
tools/migrate_legacy_tokens.sh --check old_truth.vcf.gz   # report only; exit 10 = legacy

Idempotent: safe to run on a file that's already current, or on a non-eidolon VCF, so you can call it unconditionally in a pipeline. It rewrites the header declarations and the record fields together, so the result is a valid VCF.

Note you cannot work around this with a dual-name bcftools filter — bcftools rejects an undefined tag in a -i expression at parse time, so even INFO/EIDOLON_ORIGIN="somatic" || INFO/NEAT_ORIGIN="somatic" fails outright on a file that carries only one of the two. Convert the file instead.

Read names — NOT converted, and this is the part that can bite you

Read names are not rewritten, in either FASTQ or BAM. Rewriting files that are routinely hundreds of GB to change ~19 bytes per record isn't a reasonable ask, so instead eidolon filter-reads accepts both prefixes natively — legacy FASTQs keep working with no conversion step, and it warns once when it sees an old prefix.

Nothing protects your own scripts. A grep '^@RNEAT_generated_', awk field split, or regex over read names will match zero records and exit 0 against v3.0.0 output — a silent empty result, not an error. Audit for the old prefix before upgrading:

grep -rn 'RNEAT_generated_\|RNEAT_chimeric_' your_scripts/

Best fix: make your parser prefix-agnostic

Only the prefix changed. Everything after _generated_<contig>_<start>_<end>_<uniq>/<mate> — is byte-for-byte identical between versions (verified across every read of a golden BAM re-prefixed both ways). So rather than rewriting files, strip the prefix and your script works against either version, and against any future rename:

# version-proof: drop whatever prefix is present, keep the encoded fields
samtools view x.bam | cut -f1 | sed -E 's/^[A-Z]+_generated_//'
zcat x_r1.fastq.gz  | awk 'NR%4==1' | sed -E 's/^@[A-Z]+_generated_//'

Same trick for chimeric reads: sed -E 's/^@?[A-Z]+_chimeric_//'.

If you are joining an old artifact against a new one on read name, normalize both sides this way. One unrelated gotcha for QNAME joins: eidolon's golden BAM keeps the /1 /2 mate suffix, while bwa strips it from aligned BAMs — so strip that too (sed 's|/[12]$||') when joining a golden BAM to an aligner's output. That mismatch predates this release.

If you must rewrite the files instead

# FASTQ (expensive — a full re-compress; prefer the prefix-agnostic parse above)
zcat old_r1.fastq.gz | sed 's/^@RNEAT_generated_/@EIDOLON_generated_/' | gzip > new_r1.fastq.gz

# BAM QNAMEs (QNAME is field 1, and no header line contains the prefix, so ^ is safe)
samtools view -h old.bam | sed 's/^RNEAT_generated_/EIDOLON_generated_/' | samtools view -b -o new.bam

BAM QNAMEs are covered by no in-tree tooling — filter-reads reads FASTQ, and the converter is bcftools-based so it cannot touch a BAM. Nothing eidolon ships parses BAM read names either, so this only affects your own scripts.

How to use eidolon

Prerequisites

The easiest way to install eidolon is via Bioconda:

conda install -c bioconda eidolon

This pulls a prebuilt binary with all dependencies handled — no Rust toolchain required. If you prefer to build from source or grab a release binary, read on.

You will need to install the rust toolchain to compile eidolon, including cargo. Check the cargo documentation for instructions (https://doc.rust-lang.org/cargo/getting-started/installation.html). Alternatively, you can try one of the binaries on the release page. Select the one that matches your system and let us know if you run into errors. During compilation, you may run into errors, such as cmake not found. Some of the packages eidolon uses have these dependencies. For Debian/Ubuntu this should be a simple sudo apt install cmake and for RHEL/Rocky type distros this should be sudo dnf install cmake. There may be some other requirements. Drop a comment if you need specific help.

Download the executable in the release (current version 3.0.0).

$ eidolon --help
Usage: eidolon [OPTIONS] [SUB-COMMAND]

SUB-COMMANDS:
  gen-reads              Generates reads for an input dataset
  filter-reads           Filters the output of gen-reads
  gen-mut-model          Generates a mutation model from real VCF data
  gen-seq-error-model    Generates a sequencing error model from real FASTQ data
  gen-frag-length-model  Generates a fragment length model from a BAM or SAM file
  gen-gc-bias-model      Generates a GC bias model from a reference FASTA and aligned BAM
  gen-bam-models         Builds multiple models (frag-length, GC bias) from one BAM in a single pass
  compare-vcfs           Compares a NEAT-simulated golden VCF against a downstream variant-caller VCF
  gen-cancer-reads       Simulates a tumor/normal mixture (two gen-reads passes + merge)
  help                   Print this message or the help of the given subcommand(s)

Options:
      --log-level [<log_level>]  Sets the log level for the display log. [default: trace] [possible values: trace, debug, info, warn, error, off]
      --log-dest <log_dest>      Sets the log destination (full path with full filename) for the written log
  -h, --help                     Print help

To check options for a subcommand:

$ eidolon gen-reads --help
Generates reads for an input dataset

Usage: eidolon gen-reads [OPTIONS]

Options:
  -c, --configuration-yaml <configuration_yaml>  Path to configuration file.
  -h, --help                                     Print help

To run filter reads, check the help menu.

$ eidolon filter-reads --help
Filters the output of gen-reads

Usage: eidolon filter-reads --configuration-yaml <configuration_yaml>

Options:
  -c, --configuration-yaml <configuration_yaml>  Path to configuration file.
  -h, --help                                     Print help

To run gen-mut-model:

$ eidolon gen-mut-model --help
Generates a mutation model from input VCF data

Usage: eidolon gen-mut-model [OPTIONS]

Options:
  -c, --configuration-yaml <configuration_yaml>  Path to configuration file.
  -h, --help                                     Print help

Use the help menu to see the available options and leave an issue if you find something bad happening.

To compile and run eidolon yourself, besides the rust toolchain, you will need git installed for your operating system. You will then need to git clone and cd into the repo directory. From your home directory in Linux the process might look something like:

~/$ git clone git@github.com:ncsa/eidolon.git
~/$ cd eidolon
~/eidolon/$

For Windows and Mac users, try the binary packaged with the latest version of eidolon.

Once in the repo, you can build the program either in debug (default) or release mode. The main difference is how much info it gives you if there is an error. Release mode also has some optimizations to run it faster.

~/eidolon/$ cargo build --release

If you prefer to run the package directly without using the binary, you can also use

~/eidolon/$ cargo run -- gen-reads -c my_config.yml

Rust will download any required packages. Compiling Rust code is the slowest part of the process. The final binary will be built and the program run immediately after in the second case. To run the program manually, from the repo main dir, run

~/eidolon/$ ./target/release/eidolon -h

eidolon uses a configuration file to read values it needs for the run. A command line execution might look like this:

~/eidolon/$ ./target/release/eidolon -c /path/to/filled/in/config.yml

If you record the output in the logs of Seed string to regenerate these exact results: XXXXXXX, you should be able to use that string as input with rng_seed and reproduce your results.

Fastq Output

The fastq output will have a key name that identifies the block where the read was drawn from, for quick comparisons in alignments. The output BAM file will contain the original sequence and cigar string. The name will have the format EIDOLON_generated_<contig short name>_<fragment_start>_<fragment_end>_<uniq>/1 (or /2 for the second read in a pair), where start and end are zero-padded to 10 digits and <uniq> is a 16-digit hex per-fragment tag that keeps same-position fragments from colliding (see #210).

@EIDOLON_generated_Chromosome_0000000000_0000000353_000000000000002a/1
CTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTTAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGC
+
>AC7<GDEGGGGEFGA<GFCGG;GGGGGF>GEGGEGGGFGFEFGCEGGGGGGCG:AEFGFFGG>FG;GDGA9$GGAGF=GFG=EFFCGGGFGGGGGC$BFGEFFAGGG9F7E@>?GFGGGG>EBFGFDG)DGC6DEDFA2EG:EGG%FFB

The above example comes from the chromosome in the reference (which was simply named "Chromosome") between 0 and 353, which is the size of a fragment in the simulated DNA. If there is a pair with this read, it will have the same coordinates, though it started at index 352 instead.

BAM Output

eidolon can write a golden BAM file alongside the FASTQ output. The BAM contains the same reads as the FASTQ — same sequences, same quality scores, same variants and sequencing errors applied — with alignment information included. To enable it, set produce_bam: true in your gen-reads config. The output path is derived automatically from output_filename (e.g. output_filename: my_runmy_run.bam). Please note that the BAM has a higher overhead than the fastq, and may take longer to produce.

produce_bam: true

The CIGAR strings in the BAM reflect the full ground-truth alignment:

  • Genomic variants (SNPs, insertions, deletions) are encoded as M, I, and D ops.
  • Sequencing error indels are also encoded: deletion errors add D ops for skipped reference bases; insertion errors add I ops for inserted bases.

The BAM is written in coordinate-sorted order. No post-processing sort is required before indexing:

samtools index my_run.bam

Note: heterozygous variants are applied probabilistically, identical to the FASTQ. A read drawn to the reference allele will not show the variant in either the FASTQ or the BAM.

Targeted Generation with a BED File

For exome, targeted-panel, or any run where you only want reads over specific regions, you can supply a BED file at generation time:

target_bed: /path/to/targets.bed

When target_bed is set, gen-reads skips contigs absent from the BED entirely — no blocks are read, no variants are placed, and no reads are generated for those contigs. Within covered contigs, reads and variants are generated only over the intersecting non-N regions. This is the recommended approach for targeted runs on large genomes; it is far more efficient than generating genome-wide reads and post-filtering with filter-reads.

The BED contig names must match the short names derived from the reference FASTA (the text after > up to the first whitespace character). Both .bed and .bed.gz inputs are accepted.

Custom Mutation Rate Regions with a BED File

In addition to targeting certain regions, you can use a BED file with a custom field entered in any column after the third.

mutation_regions: /path/to/mutation_regions.bed

The text pattern is "mut_rate=0.0001" followed by a delimiter (end of line, space, semicolon, comma, bar) where the number after the equal sign is any float, and will be the mutation rate for the region defined in columns 1-3.

chr1    39930   39957   Bed_info    mut_rate=0.002
chr2    0   111199  Other_bed_info  mut_rate=0.02

Any region outside of the regions defined in the mutation regions BED will be assigned the default mutation rate, set by the mutation model, which can be overridden a custom default defined in the config file. For example, if you only want to have mutations in exomes, but you want reads from the full genome, you could set the mutation_rate to 0.0 and use a bed file defining all exomes, with a column appende mut_rate=0.0011 or whatever mutation rate you desire. This BED works in conjunction with the target_bed, and any region outside the target bed will be excluded from reads anyway, and thus will have no variants.

Input Variants VCF

You can supply a VCF of variants to force into the simulation:

input_vcf: /path/to/variants.vcf.gz

eidolon will place every variant from the VCF into the corresponding position in the simulated reads and the output VCF. Random variants are still generated at mutation_rate for all positions not covered by the input VCF; set mutation_rate: 0.0 to disable random variants entirely and output only the provided set of variants.

Requirements

  • The VCF must be single-sample (one sample column).
  • Every record must include GT in the FORMAT field. eidolon uses the genotype to determine whether to apply the variant to all reads covering the position (homozygous, e.g. 1/1) or only a probabilistic subset (heterozygous, e.g. 0/1). Records without GT are rejected.
  • Contig names must match the short names derived from the reference FASTA (text after > up to the first whitespace character). Variants on unrecognised contigs are skipped with a warning.
  • Both .vcf and .vcf.gz files are accepted.

Supported variant types

Type Condition Handled
SNP REF and ALT both single base Yes
Insertion single-base REF, multi-base ALT Yes
Deletion multi-base REF, single-base ALT Yes
Symbolic SV ALT is <DEL> / <DUP> / <CNV> / <INS> / <INV> / breakend / other <TAG> Yes — see "Symbolic / structural variants" below
Literal complex multi-base REF and multi-base ALT (literal bases) No — skipped with warning

Symbolic / structural variants

Symbolic ALTs (VCF 4.2 §1.4) are accepted and round-tripped to the output VCF verbatim, with INFO/END, INFO/SVLEN, and INFO/CN preserved. As of v1.10, eidolon can also generate symbolic SVs de novo from a learned model — opt in by setting sv_rate_scale: 1.0 (or higher) in your gen-reads YAML; see "De novo SV generation" below.

SV Effect on read depth Effect on read sequence
<DEL> hom → ×0, het → ×(ploidy−1)/ploidy; or ×CN/ploidy if INFO/CN is set none — bases in the deleted span just stop producing reads
<DUP> hom → ×2, het → ×(ploidy+1)/ploidy; or ×CN/ploidy if INFO/CN is set none — extra reads come from the forward-strand reference
<CNV> ×CN/ploidy when INFO/CN is set; otherwise warned and passed through with no depth change none
<INS> none (insertion at a single anchor base — no span to modulate) none — the inserted sequence is not synthesized
<INV> none in this release not modeled — reads come from the forward-strand reference, not the inverted sequence
Breakends, unknown <TAG> none none — round-tripped only

DEL anchor convention: for <DEL>, POS is the unaffected base immediately before the deletion (per VCF 4.2), so the modulated span is [POS+1, END] in 1-based coords. For <DUP> / <CNV> / <INV>, POS is the first base of the affected region, so the span is [POS, END].

When an SV zeroes out coverage (hom <DEL> or INFO/CN=0), the mutation rate over the same span is also zeroed so de-novo SNPs don't pollute the output VCF with variants that never appear in reads.

Current caveats

  • Multi-allelic records: only the first ALT allele is used; additional alleles are silently ignored. Split multi-allelic records with bcftools norm -m - before passing to eidolon. (This is true for both literal and symbolic ALTs — <DEL>,<DUP> on the same line is treated as the first ALT only.)
  • REF allele verification: eidolon does not check that the REF field matches the reference sequence at that position. Mismatches will produce biologically incorrect output without any warning.
  • Literal complex variants: records whose REF and ALT are both multi-base strings (and the ALT is literal bases, not a <TAG>) are skipped with a logged warning and do not appear in the output.
  • <INV> interior is forward-strand: inversion junction reads are emitted (the chimeric signal callers use to detect the inversion), but reads from the interior of an inverted span are still transcribed from the forward-strand reference. The <INV> record round-trips to the output VCF.
  • Breakends: <BND> junction reads are generated (chimeric reads spanning the mate locus; validated against Manta — see the ACCESS report), and the record round-trips to the output VCF.

De novo SV generation

eidolon can sample symbolic SVs (<DEL>, <DUP>, <CNV>) directly from a learned SvModel rather than relying on user-supplied records. Generation is off by default (opt-in via sv_rate_scale) so v1.9 pipelines remain unchanged.

To enable, add a single line to your gen-reads YAML:

sv_rate_scale: 1.0
  • 0.0 (the default) disables de novo SV generation entirely — only input_vcf records flow through.
  • 1.0 reproduces the rate from the trained model.
  • Larger values scale the rate proportionally for stress testing.

When enabled, eidolon consults MutationModel.sv_model:

  1. If you trained your own model with eidolon gen-mut-model -c <yaml> against an SV-rich VCF (e.g. a gnomAD-SV slice), the model file includes a fitted SV component covering type / length / copy-number / homozygous frequencies. Pass it via mutation_model: /path/to/your.json.gz in the gen-reads YAML.
  2. If you don't supply a model, gen-reads loads the bundled default. The default carries approximate gnomAD-SV v2.1 parameters — useful for kicking the tires, but not a substitute for retraining on data that matches your downstream use case. See eidolon-core/src/models/sv_model_defaults.rs for the parameter sources.

Per-contig sampling: Poisson count from per_base_rate × contig_len × sv_rate_scale → weighted type pick → log-normal length (rejected outside [50bp, contig_len / 4]) → uniform anchor with overlap and N-gap rejection → INFO/CN draw for <CNV> → Bernoulli for genotype.

De novo records merge with input_vcf SVs and flow through the same depth-modulation path, so simulated coverage and the golden VCF round-trip behave identically for both sources. compare-vcfs skips both into the skipped.symbolic bucket — symbolic ALTs aren't byte-comparable.

Caveats:

  • The bundled default is a literature-derived approximation, not a refit on the actual gnomAD VCFs. Don't use it for distribution-faithful benchmarking — retrain.
  • <INV> and breakends are not generated (the read content for either isn't modeled yet).
  • A trained model's sv_model field is None if the training VCF lacked sufficient SV observations (< 2 per type after filtering). Loading that model with sv_rate_scale > 0 is harmless — generation just no-ops.

FASTQ Shuffling

eidolon writes reads in contig order. To shuffle the output, use seqkit shuffle as a post-processing step:

# single-ended
seqkit shuffle sample.fastq.gz -o sample_shuffled.fastq.gz

# paired-ended (keeps mates in sync)
seqkit shuffle -2 sample_R1.fastq.gz sample_R2.fastq.gz \
    -o sample_R1_shuffled.fastq.gz -o sample_R2_shuffled.fastq.gz

seqkit uses reservoir sampling and streams from disk, keeping memory use bounded regardless of file size (seqkit is an open source toolkit for FASTQ files: https://github.com/shenwei356/seqkit).

3′ Adapter Readthrough

Real Illumina libraries whose insert is shorter than the read length "read through" the fragment into the 3′ sequencing adapter — the read's tail is adapter sequence, not genome. eidolon can simulate this so short-insert data looks realistic and exercises downstream adapter-trimming QC. Disabled by default — output is byte-identical to prior versions when the adapters block is omitted.

adapters:
  enabled: true
  preset: truseq        # truseq | nextera | custom
  # for preset: custom, give explicit 5′→3′ uppercase-ACGT sequences:
  # r1: AGATCGGAAGAGC...
  # r2: AGATCGGAAGAGC...

When enabled, any fragment whose insert is shorter than read_len is kept (instead of being resampled away) and the read is padded to read_len at its 3′ end with adapter sequence — R1 gets r1, R2 gets r2 (appended after R2 is reverse-complemented, matching real read orientation). Adapter bases carry the same quality/error models as genomic bases, are marked soft-clipped (S) in the golden BAM, and never introduce variants. How much readthrough you get is controlled by how many inserts fall below read_len — i.e. by fragment_mean / fragment_st_dev relative to read_len. With a long-insert setting (fragment_meanread_len) essentially no reads reach the adapter and enabling this changes nothing.

Presets:

  • truseq — Illumina TruSeq (AGATCGGAAGAGC…), the most common.
  • nextera — Nextera / transposase (CTGTCTCTTATACACATCT).
  • custom — supply your own r1 / r2.

Not compatible with long_reads: true (adapter readthrough is a short-read phenomenon).

When to enable it:

  • Validating adapter-trimming pipelines — generate reads with known adapter content to confirm fastp / cutadapt / Trim Galore settings actually detect and remove it.
  • Short-insert libraries — small-RNA / cfDNA / degraded-DNA style data where inserts sit near or below the read length and readthrough is expected; the simulated reads then match what the sequencer really produces.
  • Aligner soft-clip benchmarking — untrimmed adapter tails should be soft-clipped by the aligner; use this to check that behaviour end-to-end.
  • Realistic FASTQ→VCF tests — exercise the whole trim → align → call path on data that carries adapters instead of idealized adapter-free reads.

To keep short inserts as genomic reads without modeling adapters (e.g. to study the coverage behaviour of a short-insert library on its own), set keep_short_fragments: true instead of enabling adapters — short fragments are then emitted as insert-length reads with no adapter padding.

Validated behaviour (paired germline benchmark: chr22, 30×, TruSeq, 3 reps/arm, BWA-MEM2 → GATK HaplotypeCaller vs the golden VCF): adapter readthrough is detectable (fastp adapter content and aligner soft-clip fraction rise only when it is enabled) and fully callable — SNP and indel recall/precision/F1 are unchanged within replication noise whether the adapters are fastp-trimmed or left for BWA-MEM2 to soft-clip. An adapter-free short-insert control showed the only fidelity difference versus a long-insert baseline is the reduced effective coverage of short inserts (mate overlap), not the adapters.

Parallel Processing

eidolon gen-reads processes contigs in parallel by default using rayon's work-stealing thread pool. Each contig is an independent unit of work — variant generation, fragment sampling, and FASTQ/BAM writing all happen concurrently across contigs — so references with many contigs scale well across cores.

Output is byte-identical regardless of num_threads (the same seed always produces the same reads in the same order), so you can change the thread count freely without affecting results.

A note on scaling: read generation is largely memory-bandwidth bound, so on references dominated by one or a few large chromosomes the wall-time gain from extra cores is limited — the bottleneck is memory throughput, not CPU. An experimental sub-contig chunk size knob (below) can split a single chromosome across cores, but it is disabled by default because in our benchmarks it did not improve wall time and occasionally regressed it.

Thread count:

By default eidolon uses all available logical cores. You can cap the thread count with the num_threads config key:

# use 4 threads instead of all available cores
num_threads: 4

or disable parallelism entirely (useful for debugging or reproducibility testing)

# disable parallelism entirely (useful for debugging or reproducibility testing)
num_threads: 1

Omit num_threads (or set it to .) to restore the default all-cores behaviour.

Thread count and hardware — fewer threads can be faster:

Read generation moves a lot of data relative to the arithmetic it does, so it is largely memory-bandwidth bound. On a typical desktop or laptop (which has only a couple of memory channels), a single eidolon thread can already saturate much of the available memory bandwidth — so adding cores yields little speedup and, past a point, can even run slower as threads contend for the memory bus. In our desktop benchmarks, large references ran about as fast (sometimes faster) on 1–4 threads as on all 8.

Practical guidance:

  • Desktop / laptop: try num_threads: 1 (or a small number) and compare — it is often as fast or faster than all-cores for a single large run, and leaves cores free for other work. If you are simulating many samples, running several single-threaded eidolon jobs in parallel typically beats one many-threaded job.
  • HPC nodes with many memory channels (and multiple sockets) have far more aggregate bandwidth, so higher num_threads scales better there.
  • Output is byte-identical regardless of num_threads, so it is safe to tune the thread count purely for speed on your hardware.

Chunk size (experimental, opt-in):

By default each contig is one unit of work. Setting chunk_size splits contigs into sub-contig chunks so a single large chromosome can be worked by several cores at once. It is off by default: read generation is memory-bandwidth bound, so chunking did not improve wall time in our benchmarks (and added a little overhead). It is kept for CPU-bound or very-many-core scenarios where it may help. The size is in base pairs and independent of the thread count, so output stays byte-identical regardless of num_threads.

# default — disabled (one chunk per whole contig); omit or set to . or 0
chunk_size: 0

# opt in: fixed chunk size in base pairs
chunk_size: 5000000

When might it help? Only when read generation is CPU-bound rather than memory-bandwidth bound — the opposite of what we measured on a typical desktop. Consider trying it when both are true:

  1. Your reference is dominated by one or a few large contigs, so the default per-contig parallelism leaves most cores idle (e.g. a single-chromosome assembly, or a genome where one chromosome dwarfs the rest).
  2. You have memory bandwidth to spare relative to cores — a multi-socket or many-memory-channel HPC node rather than a commodity desktop — and/or you run compute-heavier settings (GC-bias-weighted coverage, long-read mode, very high coverage) where per-read CPU work dominates memory traffic.

It is not worth enabling on a typical workstation, or on references with many contigs (those already parallelize per contig). Always benchmark on your own hardware: start with chunk_size ≈ longest_contig_bp / (4 × cores) (a few chunks per core), compare wall time against the default, and keep it only if it is actually faster.

BAM output is fully parallel:

eidolon uses a per-contig temp-file strategy: each contig worker writes its alignment records to a private temporary BAM body file, then a single concatenation pass assembles them in reference order into the final coordinate-sorted BAM.

Reproducibility:

Each contig's random number generator is derived deterministically from the parent seed and the contig's position in the reference, so output is identical across runs with the same seed even when the number of threads changes.

Reading Bed Data

eidolon can now read bed data and filter the reads based on regions specified. This comes with some caveats. First is that rust can't handle any header lines or non-header rows in the bed file, because of potential range of possibilities. Second, the names must match what is in the fasta. Third, eidolon can only filter, and does not use the rest of the bed information. It treats each record as a region of interest only.

Bed data will have some challenges. For example, if the contig names in the bed file don't match the assumed contig name from the fasta file, how will rust be able to know which is what? To make things work, we are going to assume, for now, that the bed file contig names match the names as derived by eidolon. To determine this:

First, in a linux terminal, use your input fasta to find the names of the contigs like this:

$ grep "^>" input.fasta
>NC_001133.9 Saccharomyces cerevisiae S288C chromosome I, complete sequence
>NC_001134.8 Saccharomyces cerevisiae S288C chromosome II, complete sequence
>NC_001135.5 Saccharomyces cerevisiae S288C chromosome III, complete sequence
>etc

This will give you the full fasta name. eidolon determines the short name of the input fasta by skipping the initial '>' character, then taking the string up to the first whitespace delimiter. In the above example, the short names are "NC_001133.9", "NC_001134.8", etc.

Next, we check the bed. This example awk command will look for unique values in the first column of your bed file and print out what it finds.

$ awk '!seen[$1]++ {print $1}' file.bed
1
2
3
etc

In this case, the bed file uses a simple numbering scheme to number the chromosomes. We can see a mapping with the roman numeral chromosomes in the name, but it's tricky to handle consistently. So, the following command will allow you, the user, to map these chromosomes and thus instruct eidolon. Yours will vary based on the inputs.

awk -F'\t' '{$1=($1=="1"?"NC_001133.9":$1); $1=($1=="2"?"NC_001134.8":$1); print}' OFS='\t' file.bed > file_renamed.bed

You will have to tailor this command to your dataset, but this is one way to map the names from the bed to the fasta in a way eidolon will understand.

Filtering Your Data

To run filter-reads, you must first copy the filter_reads_template.yml file from eidolon/template_config/ to a directory of your choosing. Then you can edit the file in your favorite editor. The configuration has four fields:

bed_file: /path/to/my.bed # required

A filename (full path is best) for a bed file with regions to target for filtering. It should be tab-separated in standard bed format.

In configuration:

files_to_filter: [
  # required, in list form
]

Filenames (full path is best) for files to filter by the bed file. For example, if you ran paired-ended fastqs with the vcf, your list would look like:

files_to_filter: [
   /my/home/output/bacteria_r1.fastq.gz,
   /my/home/output/bacteria_r2.fastq.gz,
   /my/home/output/bacteria.vcf.gz,
]

Note the full extension is important, but filter-reads should be able to handle both gzipped and unzipped files, if you decide to unzip them.

filter_key: .

This is the key appended to the filename, before extensions. For example, if your filename is "miscanthus_r1.fastq.gz", and you set the key as "_only_genes", the output file would be "miscanthus_r1_only_genes.fastq.gz". The default is "_filter".

overwrite_output: false # optional, default false

Set to true to allow filter-reads to overwrite existing output files. When false, the run will error if the output file already exists.

Once your files are entered and your config is saved, you can run eidolon:

$ eidolon filter-reads -c my_config.yml

Your output will give you the filenames and success status.

IMPORTANT: This feature only works on fastq files generated by eidolon. It is untested on generic VCF files, but should work. The reason it only works with eidolon-generated fastq files is that eidolon uses a naming scheme that the parser can use to identify where the read is located (enabling filtering), whereas an average fastq will not have that info.

Generating a Mutation Model

eidolon now includes the ability to read in real data and learn the parameters to reproduce it in a simulation run. So far, this is limited to the mutation model, using the eidolon gen-mut-model subcommand.

$ eidolon gen-mut-model -c gen_mut_model_config.yml

The inputs are a single-sample VCF and the reference FASTA the VCF was called against. eidolon computes statistics for indels and SNPs and builds the trinucleotide model of SNP generation, as in the original eidolon. The output is a gzipped JSON model file that can be passed directly to gen-reads via its mutation_model config key.

Copy template_config/gen_mut_model_template.yml to a directory of your choosing and fill in the fields:

# required: path to the reference FASTA used to call the VCF
reference: /path/to/reference.fa

# required: path to a single-sample VCF file
# The VCF must include FORMAT and SAMPLE columns, and GT must be present in FORMAT.
# QUAL=. is accepted and treated as 0.
vcf_file: /path/to/variants.vcf

# required: output path for the generated model; should end in .json.gz
output_file: /path/to/output_model.json.gz

# optional: restrict model learning to regions in this BED file
# set to . (dot) to use the entire reference (default)
bed_file: .

# optional: set to true to overwrite an existing output file (default: false)
overwrite_output: false

# optional: custom 4x4 SNP transition matrix TSV (rows/columns: A C G T).
# A single header line is allowed. Diagonal values are zeroed automatically.
# Overrides the transition matrix inferred from VCF SNP data.
transition_matrix_file: /path/to/matrix.tsv

VCF requirements:

  • Single sample only — multi-sample VCFs are not yet supported (tracked in #412)
  • Each variant record must have GT in the FORMAT column; eidolon hard-errors if GT is missing
  • QUAL=. is accepted and treated as quality score 0

Caveats: Only one sample can be read at this point (#412). Currently, high-mutation regions and common variants features from Python NEAT are not yet implemented (#413).

Try it out and let us know if you run into any issues!

We will continue to improve this process in the future. If you have suggestions for parsing names to facilitate this, let us know in the Issues section!

Generating a Sequencing Error Model

eidolon can also learn a sequencing error model from real FASTQ data using the eidolon gen-seq-error-model subcommand. This reads per-base quality scores from the FASTQ to build a Markov quality score model and computes an average base error rate. Optionally, you can supply a BAM file or a custom TSV to set the SNP transition matrix (which base errors are most likely to become which other bases).

$ eidolon gen-seq-error-model -c gen_seq_error_model_config.yml

The output is a gzipped JSON model file that can be passed directly to gen-reads via its seq_error_model config key.

Copy template_config/gen_seq_error_model_template.yml to a directory of your choosing and fill in the fields:

# required: path to input FASTQ file (.fastq or .fastq.gz)
fastq_file: /path/to/reads.fastq.gz

# required: output path for the generated model; should end in .json.gz
output_file: /path/to/seq_error_model.json.gz

# optional: set to true to overwrite an existing output file (default: false)
overwrite_output: false

# optional: maximum number of reads to use for model learning; 0 = unlimited (default: 0)
max_reads: 0

# optional: quality score ASCII offset; 33 for Illumina 1.8+/Sanger, 64 for older Illumina (default: 33)
qual_offset: 33

# optional: list of Q-score bins to quantize the learned model to (e.g. NovaSeq 6000 uses
# [2, 12, 23, 37]). When set, each observed Q-score is snapped to its nearest bin before
# the model is built, and gen-reads will emit only these values. Omit for a continuous model.
# Bins must be < 94 and cannot include 31 (encodes to '@' under Phred+33).
# binned_quality_bins: [2, 12, 23, 37]

# optional: aligned BAM file to infer the SNP transition matrix from read-vs-reference mismatches.
# The BAM must have MD tags. If your aligner did not add them, run:
#   samtools calmd -b aligned.bam reference.fa > aligned_with_md.bam
# Ignored if transition_matrix_file is also set.
bam_file: /path/to/aligned.bam

# optional: custom 4x4 SNP transition matrix TSV (rows/columns: A C G T).
# A single header line is allowed. Diagonal values are ignored.
# Takes precedence over bam_file.
transition_matrix_file: /path/to/matrix.tsv

SNP transition matrix priority:

  1. transition_matrix_file (explicit TSV) — highest priority
  2. bam_file (inferred from MD-tagged BAM mismatches)
  3. Default matrix from Python eidolon — used when neither is provided

BAM MD tag requirement: The BAM path requires MD tags to identify reference bases at mismatch positions. Most aligners (BWA-MEM, STAR with --outSAMattributes MD) add them automatically. If yours does not, generate them with:

samtools calmd -b aligned.bam reference.fa > aligned_with_md.bam
samtools index aligned_with_md.bam

TSV format: The transition matrix TSV has 4 data rows (one per reference base: A, C, G, T) and 4 whitespace-separated columns (one per read base: A, C, G, T). The first row is skipped if it is non-numeric (treated as a header). Diagonal values are zeroed automatically. Rows are re-normalized to sum to 1.

A    C    G    T
0.0  0.5  0.3  0.2
0.5  0.0  0.3  0.2
0.4  0.3  0.0  0.3
0.3  0.3  0.4  0.0

Binned quality scores: Modern Illumina platforms (NovaSeq 6000, NextSeq 1000/2000, the simplified MiSeq reporting modes) no longer emit the full continuous Q0–Q40 range. Instead, they quantize each per-base quality into a small set of discrete bins — for example, NovaSeq 6000 emits only {2, 12, 23, 37}. Set binned_quality_bins in the config to mimic this behaviour:

binned_quality_bins: [2, 12, 23, 37]

When this field is set, gen-seq-error-model snaps each observed Q-score from the input FASTQ to its nearest bin (ties round down) before learning seed, transition, and global-frequency counts. The resulting model file is flagged binned_scores: true and lists the bin values as its quality_score_options. gen-reads then samples only those bin values when emitting reads — no extra flag needed on the read-generation side.

Validation rules:

  • Bins must be non-empty integers in [0, 94) (entries are sorted and deduped automatically).
  • Value 31 is rejected — under Phred+33 it encodes to @, which would corrupt FASTQ output. If you need a bin near Q31, pick 30 or 32.
  • Bins with no observed counts in the training FASTQ are still kept in quality_score_options; their transition rows fall back to a uniform distribution, and a warning is logged listing the empty bins.

Some common platform bin sets (consult your sequencer's documentation for the authoritative list):

Platform Suggested bins
NovaSeq 6000 (4-bin) [2, 12, 23, 37]
NextSeq 1000/2000 (3-bin) [2, 15, 35]
NextSeq 1000/2000 (4-bin) [2, 12, 23, 37]

Generating a GC Bias Model

eidolon can learn a GC bias model from a reference FASTA and an aligned BAM file using the eidolon gen-gc-bias-model subcommand. It walks the BAM once to accumulate per-base reference coverage, tiles the reference in fixed-size windows, computes the GC% of each window, looks up the mean coverage over that window, and accumulates the data into a 101-bin weight table (one bin per integer GC percentage, 0–100%). The resulting model can be passed to gen-reads to make fragment start positions favour regions whose GC content matches the coverage bias observed in your data.

$ eidolon gen-gc-bias-model -c gen_gc_bias_model_config.yml

The output is a gzipped JSON model file that can be passed directly to gen-reads via its gc_bias_model config key.

Copy template_config/gen_gc_bias_model.yml to a directory of your choosing and fill in the fields:

# required: reference FASTA used to compute GC content
# Both plain and gzipped (.fa.gz) references are accepted.
reference: /path/to/reference.fa

# required: aligned BAM. Coverage is accumulated in process per reference base.
bam_file: /path/to/aligned.bam

# optional: minimum mapping quality applied while accumulating coverage.
# Default 0 matches `samtools depth` defaults.
min_mapq: 0

# optional: BED file restricting model inference to target regions
# Use "." (dot) to use the entire reference (default)
bed_file: .

# required: output path for the generated model; should end in .json.gz
output_file: /path/to/gc_bias_model.json.gz

# optional: set to true to overwrite an existing output file (default: false)
overwrite_output: false

# Window size in base pairs for GC% and coverage averaging.
# Should match the typical read length (or fragment length for long reads).
# Default: 100
window_size: 100

# Step between successive windows. Must not exceed window_size.
# Use the same value as window_size for non-overlapping windows (recommended).
# Values smaller than window_size produce overlapping windows.
# Default: window_size
window_stride: 100

# Bins with fewer windows than this receive a neutral weight of 1.0 rather than
# a learned weight. Increase this to require more evidence before trusting a bin.
# Default: 10
min_windows_per_bin: 10

BAM filtering: unmapped, secondary, and supplementary records are skipped automatically. Reads with mapping quality <= min_mapq are dropped before contributing to coverage. The default min_mapq: 0 reproduces samtools depth defaults; set it to 20 if your downstream gen-reads runs assume mapq-filtered coverage.

Large genomes: The tool walks the BAM once and allocates a per-contig depth array (u32 per reference base) only for contigs that receive at least one record. Peak memory for hg38 at 30× is on the order of all-contigs-summed depth arrays — see the HPC section below for sizing.

Long reads: Set window_size to approximately your typical read length (e.g. 5000–50000 for ONT or PacBio). Larger windows mean fewer windows per contig and faster model building. Non-overlapping windows (window_stride: window_size) are recommended so each observation is independent.

If the model has no effect in gen-reads: If every GC% bin in your reference has fewer observations than min_windows_per_bin, all weights will be neutral (1.0) and no bias will be applied. This is logged as a warning. To diagnose, lower min_windows_per_bin or increase the region covered (use a larger reference or remove the BED restriction).

Using the model in gen-reads:

# in gen_reads_config.yml
gc_bias_model: /path/to/gc_bias_model.json.gz

# optional: inflate fragment count to compensate for low-weight regions
# true (default): total coverage stays close to the requested depth
# false: coverage in low-GC regions will be lower than requested
gc_bias_normalize_coverage: true

Generating a Fragment Length Model

eidolon can learn a fragment length model from real paired-end alignment data using the eidolon gen-frag-length-model subcommand. It reads a BAM or SAM file, collects the template lengths (TLEN) of confidently-mapped concordant read pairs, filters out rare and extreme-outlier lengths, then fits a normal distribution to the result and writes a FragmentLengthModel that gen-reads can use.

$ eidolon gen-frag-length-model -c gen_frag_length_model_config.yml

The output is a gzipped JSON model file that can be passed directly to gen-reads via its fragment_model config key.

Copy template_config/gen_frag_length_model_template.yml to a directory of your choosing and fill in the fields:

# required: path to input BAM or SAM file
# The file must contain paired-end aligned reads. BAM is strongly recommended.
input_file: /path/to/aligned.bam

# required: output path for the generated model; should end in .json.gz
output_file: /path/to/fragment_length_model.json.gz

# optional: minimum number of reads for a fragment length to be included in the model
# Default is 2 to handle smaller datasets. Set to 0 to disable filtering entirely.
# For larger datasets (e.g. whole-genome), try 100 and adjust from there.
min_reads: 2

# optional: set to true to overwrite an existing output file (default: false)
overwrite_output: false

Read filtering rules:
Only reads that satisfy all of the following are used:

  • Paired-end and first in pair
  • Mapped (not unmapped, secondary, or supplementary)
  • Mate mapped to the same reference sequence
  • Mapping quality > 10

Outlier filtering:
Fragment lengths that exceed median + 10 × MAD (median absolute deviation) are removed before fitting. This mirrors the filtering in Python NEAT's fragment length modeler. If no lengths survive the filter, lower min_reads or set it to 0.

Building multiple BAM-derived models in one pass

If you need both a fragment length model and a GC bias model from the same BAM, eidolon gen-bam-models walks the BAM once and feeds both observers from the single pass — half the I/O of running the two per-tool commands back-to-back.

$ eidolon gen-bam-models -c gen_bam_models_config.yml

Copy template_config/gen_bam_models.yml and fill in the sections for whichever models you want:

bam_file: /path/to/aligned.bam
min_mapq: 0   # walker-level filter; FragLengthObserver enforces MAPQ > 10 internally

frag_length:
  output_file: /path/to/frag_length_model.json.gz
  overwrite_output: false
  min_reads: 2

gc_bias:
  reference: /path/to/reference.fa
  output_file: /path/to/gc_bias_model.json.gz
  overwrite_output: false
  bed_file: .
  window_size: 100
  window_stride: 100
  min_windows_per_bin: 10

Both sections are optional but at least one must be present. The output models are interchangeable with what gen-frag-length-model and gen-gc-bias-model would produce on their own, so the resulting files plug into gen-reads exactly the same way.

One filter for the shared walk. The top-level min_mapq is the only MAPQ knob exposed to the unified walker, and it gates both observers. The standalone tools differ: gen-frag-length-model hard-codes its own MAPQ > 10 cutoff (via BamWalkFilter::for_frag_length()), while gen-gc-bias-model honors the min_mapq you pass it. If you want the unified runner's frag-length output to match the standalone command byte-for-byte, set min_mapq: 10; if you want the GC bias output to match a standalone run with min_mapq: 20, set min_mapq: 20. When the two policies need to differ, run gen-bam-models twice — one config per output — and the per-observer BAM iteration savings still beat running the standalone commands.

Comparing a downstream caller's VCF against the golden VCF

After running gen-reads, you can validate a downstream variant caller against the simulated truth using eidolon compare-vcfs. The subcommand classifies every variant into TP / FN / FP, catches denotation-different alternates that exact matching would mis-classify as both an FN and an FP (e.g., a left-aligned indel in the called VCF versus the same indel right-aligned in the golden), and attributes the surviving FNs to specific reasons drawn from the simulator's configuration.

$ eidolon compare-vcfs -c compare_vcfs_config.yml

Copy template_config/compare_vcfs_template.yml and fill in:

golden_vcf: /path/to/golden.vcf.gz
called_vcf: /path/to/called.vcf.gz
reference:  /path/to/reference.fa
output_dir: /path/to/report_dir
overwrite_output: false

# Optional: restrict comparison to these regions.
target_bed: .
# Optional: comma-separated list. "." treats every called contig as simulated.
contigs_simulated: .
# Optional: BED used by the simulator. Drives FN attribution.
mutation_bed: .
# Optional: TSV remapping BED chrom names (e.g., 1<TAB>chr1).
chrom_aliases: .

# Filters
include_homs: false       # ALT == REF rows
include_filtered: false   # FILTER != PASS / "."

# Equivalence sweep (NEAT 2.1 algorithm, ported)
equivalence_window: 50    # ±N bp around each FP
fast: false               # skip the sweep entirely

# Outputs
write_fp_vcf: false       # also produce FP.vcf

The run produces four files under output_dir:

  • comparison_summary.json — schema-versioned (currently 1.3.0), machine-readable. Includes TP/FN/FP totals + per-contig breakdown, precision / recall / F1, the FN attribution roll-up (outside_simulated_contigs, outside_mutation_bed, outside_target_bed, unknown), per-VCF skip counters (multiallelic, homozygous_ref, filtered, outside_target_bed, outside_simulated_contigs, symbolic), and any chrom-naming-mismatch warnings. Symbolic / structural ALTs (<DEL>, <DUP>, <CNV>, ...) are byte-incomparable, so they're counted into skipped.symbolic and excluded from TP/FN/FP classification.
  • comparison_summary.txt — same content, human-readable.
  • FN_with_reasons.vcf — every surviving FN, annotated with a EIDOLON_REASON INFO tag listing the attribution reasons.
  • FP.vcf (optional) — every surviving FP, as-is. Off by default; enable with write_fp_vcf: true.

Equivalence detection. For each false-positive variant, compare-vcfs takes a ±equivalence_window bp window of the reference and applies both the FP set and the FN set within that window. If the resulting byte sequences are identical, the two sets are alternative spellings of the same edit and every consumed FN is promoted to TP. Set fast: true to skip this pass; the report's totals.equivalents_promoted counts how many TPs were rescued by it.

FN attribution. Each surviving FN is tagged with at least one reason. If the FN's contig wasn't in contigs_simulated, that reason is reported alone (the BED checks are skipped because they presuppose the contig was simulated). Otherwise the configured BEDs are checked and unknown is the fallback. Aliases configured via chrom_aliases are applied to BED chrom names at load time, so you can compare against a reference that uses one convention (e.g., chr1) when your BED uses another (e.g., 1). When a BED has any chrom that doesn't appear in the reference's FASTA contig list (post-alias), compare-vcfs surfaces a warning in the report — useful for catching single-typo BEDs that would otherwise misattribute every variant on that contig.

Running on HPC

eidolon runs as a single process and fits naturally onto a single HPC compute node. No MPI, distributed computing, or special environment setup is required. The notes below cover resource budgets for whole-genome human-scale runs.

gen-reads

gen-reads is already multi-threaded via rayon (see Parallel Processing above). Set num_threads in your config to match your CPU allocation:

num_threads: 16

Memory scales with num_threads × largest_contig_size, not total genome size — each thread processes one contig at a time. For hg38, chr1 is ~249 Mbp, so 16 simultaneous threads need roughly 16 GB for sequence data plus overhead. Budget additional scratch space for per-contig temp files before the final assembly: roughly 3× the expected output size.

Genome Threads Recommended RAM Scratch space Typical wall time
Bacterial (~5 Mbp) 4 4 GB 5 GB < 1 min
Human hg38, 10× SE 16 32 GB 100 GB ~20 min
Human hg38, 30× PE 16 48 GB 300 GB ~60 min

Example SLURM header:

#!/bin/bash
#SBATCH --ntasks=1
#SBATCH --cpus-per-task=16
#SBATCH --mem=48G
#SBATCH --time=2:00:00
#SBATCH --tmp=300G

gen-gc-bias-model

Single-threaded; walks the BAM once and accumulates per-base reference coverage as a Vec<u32> per observed contig. Peak memory is roughly 4 bytes × total reference bases that received at least one record. For a full human genome (~3.2 Gbp) this is ~13 GB. For a single chromosome or a targeted/exome BAM it is much smaller.

If memory is tight on whole-genome runs, split the BAM by chromosome and run gen-gc-bias-model once per chromosome on a representative subset that spans your GC range of interest, then average or combine the resulting models.

Recommended SLURM header (whole-genome BAM):

#SBATCH --ntasks=1
#SBATCH --cpus-per-task=1
#SBATCH --mem=16G
#SBATCH --time=1:00:00

gen-mut-model

Single-threaded; processes the VCF one chromosome at a time. A full human genome WGS VCF (~10 GB) typically completes in 30–60 minutes with peak RSS under 4 GB.

#SBATCH --ntasks=1
#SBATCH --cpus-per-task=1
#SBATCH --mem=8G
#SBATCH --time=1:30:00

gen-seq-error-model

Single-threaded; streams through the FASTQ. For a full genome FASTQ (~600 M reads), expect 30–60 minutes. For most purposes, training on a representative subset produces a statistically equivalent model in a fraction of the time:

max_reads: 5000000   # 5 M reads is sufficient; set to 0 for unlimited
#SBATCH --ntasks=1
#SBATCH --cpus-per-task=1
#SBATCH --mem=4G
#SBATCH --time=0:30:00   # with max_reads=5M; scale up for unlimited

gen-frag-length-model

Single-threaded; streams TLEN fields from the BAM. A full human genome BAM at 30× typically completes in under 15 minutes with peak RSS under 2 GB.

#SBATCH --ntasks=1
#SBATCH --cpus-per-task=1
#SBATCH --mem=4G
#SBATCH --time=0:30:00

Environment notes

  • The eidolon binary has no runtime dependencies beyond a standard C library (glibc), which is present on all Linux HPC systems.
  • No module loads or conda environments are required — copy the release binary to your scratch or project directory and run it directly.
  • If you compile from source on the cluster, ensure cmake is available (module load cmake on most systems) before running cargo build --release.

Current Benchmarks We ran some benchmarks on eidolon on my home desktop, a very basic Linux desktop, using data pulled from public resources on the internet (mostly ncbi). The "yeast" is brewer's yeast. These are the results:

[16:26:39] Build complete.
eidolon Benchmark Report
Run:        20260510_162639
Machine:    pop-os  |  8 logical CPUs
Coverage:   10x    |  Read length: 151 bp
Binary:     /home/joshfactorial/code/eidolon/target/release/eidolon
──────────────────────────────────────────────────────────────────────
SECTION 1: Single-ended read generation
Genome          Size(MB)   Wall time  Peak RSS(MB)      CPU%
──────────────────────────────────────────────────────────────────────
[16:26:40] Single-ended: ecoli  (4.6 MB)
ecoli                4.6     0:14.83         416.9       99%
[16:26:54]   Done: wall=0:14.83  peak_rss=416.9 MB  cpu=99%
[16:26:54] Single-ended: pneumonia  (2.1 MB)
pneumonia            2.1     0:05.39         197.0       99%
[16:27:00]   Done: wall=0:05.39  peak_rss=197.0 MB  cpu=99%
[16:27:00] Single-ended: yeast  (12 MB)
yeast                 12     0:10.94         981.7      352%
[16:27:11]   Done: wall=0:10.94  peak_rss=981.7 MB  cpu=352%
[16:27:11] Single-ended: c_elegans  (97 MB)
c_elegans             97     7:35.23        8591.2      387%
[16:34:46]   Done: wall=7:35.23  peak_rss=8591.2 MB  cpu=387%
──────────────────────────────────────────────────────────────────────
Section 1 — Passed: 4 / 4  |  Failed: 0
──────────────────────────────────────────────────────────────────────
SECTION 2: Paired vs single comparison  (genome: yeast, 10x)
  Paired-end uses fragment_mean=400, fragment_st_dev=50
  Same reference, same coverage, same seed — only the read-generation mode differs.
Mode               Wall time  Peak RSS(MB)      CPU%
──────────────────────────────────────────────────────────────────────
[16:34:46] Paired comparison — single-ended pass
single-ended         0:10.48         970.4      365%
[16:34:57]   Single done: wall=0:10.48  peak_rss=970.4 MB  cpu=365%
[16:34:57] Paired comparison — paired-ended pass
paired-ended         0:13.30        1126.8      354%
[16:35:10]   Paired done: wall=0:13.30  peak_rss=1126.8 MB  cpu=354%
──────────────────────────────────────────────────────────────────────
  Paired/single wall-time ratio: 1.27x  (10.48s → 13.30s)
  Paired/single peak-RSS ratio:  1.16x  (970.4 MB → 1126.8 MB)
──────────────────────────────────────────────────────────────────────

About

Eidolon is a Rust implementation of the next-gen sequencing toolkit (NEAT). Eidolon features expanded features, including the ability to model cancer genetics, complex variants, location aware variant placement, and allele dosage.

Topics

Resources

Code of conduct

Contributing

Stars

3 stars

Watchers

2 watching

Forks

Releases

Packages

Used by

Contributors

Languages