Cleanup problem module logic

inject_solutions.bash

@@ -0,0 +1,4 @@
+#!/bin/bash
+
+gh repo clone project-lovelace/lovelace-solutions
+ln -s ../lovelace-solutions/python problems/solutions

problems/ada_lovelaces_note_g.py

@@ -67,6 +67,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.LARGE_ODD:
         n = 2 * randint(50, 125) + 1
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['n'] = n
     test_case.output['numerator'], test_case.output['denominator'] = bernoulli(n)
 

problems/almost_pi.py

@@ -42,15 +42,18 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     if test_type is TestCaseType.SMALL_N:
         N = randint(2, 10)
 
-    if test_type is TestCaseType.MEDIUM_N:
+    elif test_type is TestCaseType.MEDIUM_N:
         N = randint(11, 100)
 
-    if test_type is TestCaseType.LARGE_N:
+    elif test_type is TestCaseType.LARGE_N:
         N = randint(101, 1000)
 
-    if test_type is TestCaseType.HUGE_N:
+    elif test_type is TestCaseType.HUGE_N:
         N = randint(10000, 100000)
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['N'] = N
     test_case.output['pi'] = almost_pi(N)
 

problems/babylonian_square_roots.py

@@ -52,6 +52,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.SQUARE:
         n = randint(5, 100)**2
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['n'] = float(n)
     test_case.output['sqrt_n'] = float(babylonian_sqrt(n))
 

problems/blood_types.py

@@ -100,7 +100,7 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         donated_blood = []
 
     else:
-        raise ValueError("Unrecognized test case: {}".format(test_type))
+        raise ValueError(f"Unrecognized test case: {test_type}")
 
     test_case.input = {"patient_blood_type": patient_blood_type, "donated_blood": donated_blood}
 

problems/caesar_cipher.py

@@ -66,6 +66,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.THE_WIRE:
         plaintext = "This drug thing this aint police work I mean I can send any fool with a badge and a gun to a corner to jack a crew and grab vials But policing I mean you call something a war and pretty soon everyone is going to be running around acting like warriors They gonna be running around on a damn crusade storming corners racking up body counts And when you at war you need a fucking enemy And pretty soon damn near everybody on every corner is your fucking enemy And soon, the neighborhood youre supposed to be policing thats just occupied territory".lower()
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     known_word = random.choice(plaintext.split())
 
     shift = random.randint(1, 25)

problems/chaos.py

@@ -53,6 +53,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.DIVERGENCE:
         r = 3.6
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['r'] = float(r)
     test_case.output['x'] = logistic_map(r)
 

problems/colorful_resistors.py

@@ -108,6 +108,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         tolerance_color = str(np.random.choice(list(tolerance.keys())))
         colors = [band_color1, band_color2, band_color3, multiplier_color, tolerance_color]
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['colors'] = colors
 
     nominal_R, minimum_R, maximum_R = resistance(colors)

problems/correlation_does_not_imply_causation.py

@@ -71,6 +71,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         dataset_filename = "random_xy.csv"
         test_case.input['DYNAMIC_RESOURCES'] = [dataset_filename]
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['x'] = x
     test_case.input['y'] = y
     test_case.input['dataset_filename'] = dataset_filename

problems/definite_integrals.py

@@ -87,6 +87,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         dx = (x2 - x1) / N
         f = uniform(-1, 1, size=N).tolist()
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input = {
         "rectangle_heights": f,
         "rectangle_width": float(dx)

problems/dna_transcription.py

@@ -49,6 +49,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type == TestCaseType.INSULIN:
         dna_str = "GAGAGCCACTGCATGCTGGGCCTGGCCGGCGTTGGCACCTGTGGGCACCCAGAGAGCGTGGAGAGAGCTGGGAGGGGCTCACAACAGTGCCGGGAAGTGGGGCTTGGCCCAGGGCCCCCAAGACACACAGACGGCACAGCAGGGCTGGTTCAAGGGCTTTATTCCATCTCTCTCGGTGCAGGAGGCGGCGGGTGTGGGGCTGCCTGCGGGCTGCGTCTAGTTGCAGTAGTTCTCCAGCTGGTAGAGGGAGCAGATGCTGGTACAGCATTGTTCCACAATGCCACGCTTCTGCAGGGACCCCTCCAGGGCCAAGGGCTGCAGGCTGCCTGCACCAGGGCCCCCGCCCAGCTCCACCTGCCCCACTGCCAGGACGTGCCGCGCAGAGCAGGTTCCGGAACAGCGGCGAGGCAGAGGGACACAGGAGGACACAGTCAGGGAGACACAGTGCCCGCCTGCCCGCCAGCCCTAGGTCGCACTCCCACCCATCTCCAGCCGGGCTGGACCCAGGTTAGAGGGAGGGTCACCCACACTGGGTGTGGACCTACAGGCCCCAACGCCCACATGTCCCACCTCCTTCCCCCGCCCCGGGGCAGCGTCACAGTGGGAGCCTGAACAGGTGATCCCAGTACTTCTCCCCAGGGCCTGTCCCCAGCATCTTCCCCATCTCCTGACTATGGAGCTGCCGTGAGGCCTGGCGACAGGGGTCTGGCCCACTCAGGCAGGCAGCCACGCCCTCCTCCGGGCGTGATGGGGTGTTCGCCCAGAGGCAGGCAGCGTGGGGCACCCTGTGACCCCAGGTCACCCAGGACTTTACTTAACAAAACACTTGAATCTGCGGTCATCAAATGAGGGTGGAGAAATGGGCTGCGGGGCATTTGTTTGAGGGGCGAGTGGAGGGAGGAGCGTGCCCACCCTCTGATGTATCTCGGGGCTGCCGAAGCCAACACCGTCCTCAGGCTGAGATTCTGACTGGGCCACAGGGAGCTGGTCACTTTTAGGACGTGACCAAGAGAACTTCTTTTTAAAAAAGTGCACCTGACCCCCTGCTGGGTGGCAGCCTCCTGCCCCCTTCTGCCCATGCTGGGTGGGAGCGCCAGGAGCAGGGGGTGGCTGGGGGCGGCCAGGGGCAGCAATGGGCAGTTGGCTCACCCTGCAGGTCCTCTGCCTCCCGGCGGGTCTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTAGGTAGAGAGCTTCCACCAGGTGTGAGCCGCACAGGTGTTGGTTCACAAAGGCTGCGGCTGGGTCAGGTCCCCAGAGGGCCAGCAGCGCCAGCAGGGGCAGGAGGCGCATCCACAGGGCCATGGCAGAAGGACAGTGATCTGGGAGACAGGCAGGGCTGAGGCAGGCTGAAGGCCAGGTGCCCTGCCTTGGGGCCCCTGGGCTCACCCCCACATGCTTCACGAGCCCAGCCACGTCCTCCCTGCTGCAGAGCTGGGGCCTGGGGTCCAGCCACCCTGGAATCCTGAGCCCACCTGACGCAAAGGCCCTTGGAACAGACCTGCTTGATGGCCTCTTCTGATGCAGCCTGTCCTGGAGGGCTGAGGGCTGCTGGGCCCCCGCTGGCTTTATAGTCTCAGAGCCCATCTCCCCTACCTCTCAACCCCTGCCGCCTGGCCCATTAGGGCCTGGGGTGGGGGGGTCGGCAGATGGCTGGGGGCTGAGGCTGCAATTTCCGGACCATTT"
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['dna_str'] = dna_str
     test_case.output['rna_str'] = rna(dna_str)
 

problems/earthquake_epicenters.py

@@ -77,6 +77,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         r2 = r0 + d * array([cos(theta[1]), sin(theta[1])])
         r3 = r0 + d * array([cos(theta[2]), sin(theta[2])])
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     v = PHYSICAL_CONSTANTS['v']
 
     t1 = norm(r1-r0) / v

problems/el_nino_intensities.py

@@ -44,29 +44,41 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
 
     if test_type is TestCaseType.QUIET_YEAR:
         year = 1996
+
     elif test_type is TestCaseType.WEAK_EL_NINO:
         year = 1948
+
     elif test_type is TestCaseType.WEAK_LA_NINA:
         year = 1871
+
     elif test_type is TestCaseType.MODERATE_EL_NINO:
         year = 1914
+
     elif test_type is TestCaseType.MODERATE_LA_NINA:
         year = 2000
+
     elif test_type is TestCaseType.STRONG_EL_NINO:
         year = 1993
+
     elif test_type is TestCaseType.STRONG_LA_NINA:
         year = 1890
+
     elif test_type is TestCaseType.VERY_STRONG_EL_NINO:
         year = 2016
+
     elif test_type is TestCaseType.VERY_STRONG_LA_NINA:
         year = 1955
+
     elif test_type is TestCaseType.RANDOM_YEAR:
         year = randint(1871, 2016)
+
     else:
         raise ValueError(f"Unrecognized test case: {test_type}")
 
     test_case.input['year'] = year
 
+    # Delay solution import until tests can handle static resources:
+    # https://github.com/project-lovelace/lovelace-problems/issues/60
     from problems.solutions.el_nino_intensities import enso_classification
     classification, intensity = enso_classification(year)
 

problems/flight_paths.py

@@ -92,72 +92,75 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         lat2 = lat1
         lon2 = lon1
 
-    if test_type is TestCaseType.EQUATORIAL:
+    elif test_type is TestCaseType.EQUATORIAL:
         lat1 = 0
         lon1 = uniform(-180, 180)
         lat2 = 0
         lon2 = uniform(-180, 180)
 
-    if test_type is TestCaseType.POLE_TO_POLE:
+    elif test_type is TestCaseType.POLE_TO_POLE:
         lat1 = 90
         lon1 = uniform(-180, 180)
         lat2 = -90
         lon2 = uniform(-180, 180)
 
-    if test_type is TestCaseType.NEW_YORK_TO_MADRID:
+    elif test_type is TestCaseType.NEW_YORK_TO_MADRID:
         lat1 = PHYSICAL_CONSTANTS['New_York_lat']
         lon1 = PHYSICAL_CONSTANTS['New_York_lon']
         lat2 = PHYSICAL_CONSTANTS['Madrid_lat']
         lon2 = PHYSICAL_CONSTANTS['Madrid_lon']
 
-    if test_type is TestCaseType.VANCOUVER_TO_ST_JOHNS:
+    elif test_type is TestCaseType.VANCOUVER_TO_ST_JOHNS:
         lat1 = PHYSICAL_CONSTANTS['Vancouver_lat']
         lon1 = PHYSICAL_CONSTANTS['Vancouver_lon']
         lat2 = PHYSICAL_CONSTANTS['St_Johns_lat']
         lon2 = PHYSICAL_CONSTANTS['St_Johns_lon']
 
-    if test_type is TestCaseType.DAKAR_TO_ANTANANARIVO:
+    elif test_type is TestCaseType.DAKAR_TO_ANTANANARIVO:
         lat1 = PHYSICAL_CONSTANTS['Dakar_lat']
         lon1 = PHYSICAL_CONSTANTS['Dakar_lon']
         lat2 = PHYSICAL_CONSTANTS['Antananarivo_lat']
         lon2 = PHYSICAL_CONSTANTS['Antananarivo_lon']
 
-    if test_type is TestCaseType.ROME_TO_ISTANBUL:
+    elif test_type is TestCaseType.ROME_TO_ISTANBUL:
         lat1 = PHYSICAL_CONSTANTS['Rome_lat']
         lon1 = PHYSICAL_CONSTANTS['Rome_lon']
         lat2 = PHYSICAL_CONSTANTS['Istanbul_lat']
         lon2 = PHYSICAL_CONSTANTS['Istanbul_lon']
 
-    if test_type is TestCaseType.BENGALURU_TO_LHASA:
+    elif test_type is TestCaseType.BENGALURU_TO_LHASA:
         lat1 = PHYSICAL_CONSTANTS['Bengaluru_lat']
         lon1 = PHYSICAL_CONSTANTS['Bengaluru_lon']
         lat2 = PHYSICAL_CONSTANTS['Lhasa_lat']
         lon2 = PHYSICAL_CONSTANTS['Lhasa_lon']
 
-    if test_type is TestCaseType.MANAUS_TO_BANDUNG:
+    elif test_type is TestCaseType.MANAUS_TO_BANDUNG:
         lat1 = PHYSICAL_CONSTANTS['Manaus_lat']
         lon1 = PHYSICAL_CONSTANTS['Manaus_lon']
         lat2 = PHYSICAL_CONSTANTS['Bandung_lat']
         lon2 = PHYSICAL_CONSTANTS['Bandung_lon']
 
-    if test_type is TestCaseType.USHUAIA_TO_ALERT:
+    elif test_type is TestCaseType.USHUAIA_TO_ALERT:
         lat1 = PHYSICAL_CONSTANTS['Ushuaia_lat']
         lon1 = PHYSICAL_CONSTANTS['Ushuaia_lon']
         lat2 = PHYSICAL_CONSTANTS['Alert_lat']
         lon2 = PHYSICAL_CONSTANTS['Alert_lon']
 
-    if test_type is TestCaseType.EPIA_TO_PPIA:
+    elif test_type is TestCaseType.EPIA_TO_PPIA:
         lat1 = PHYSICAL_CONSTANTS['EPIA_lat']
         lon1 = PHYSICAL_CONSTANTS['EPIA_lon']
         lat2 = PHYSICAL_CONSTANTS['PPIA_lat']
         lon2 = PHYSICAL_CONSTANTS['PPIA_lon']
 
-    if test_type is TestCaseType.RANDOM_POINTS:
+    elif test_type is TestCaseType.RANDOM_POINTS:
         lat1 = uniform(-90, 90)
         lon1 = uniform(-180, 180)
         lat2 = uniform(-90, 90)
         lon2 = uniform(-180, 180)
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input = {
         "lat1": lat1,
         "lon1": lon1,

problems/game_of_life.py

@@ -108,6 +108,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         steps = randint(3, 10)
         grid = choice([ALIVE, DEAD], N*M, p=[0.5, 0.5]).reshape(N, M)
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['board'] = grid.tolist()
     test_case.input['steps'] = steps
 

problems/habitable_exoplanets.py

@@ -70,6 +70,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         L_star = float(uniform(0.1, 5.0, 1)[0])
         r = float(uniform(0.1, 5.0, 1)[0])
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['L_star'] = L_star
     test_case.input['r'] = r
     test_case.output['habitability'] = habitable_exoplanet(L_star, r)

problems/molecular_mass_calculator.py

@@ -54,9 +54,15 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.RANDOM_CHEMICAL:
         chemical_formula = choice(["CO2", "CH4", "C6H12O6", "PuCoGa5", "CH3NH2", "W", "C2H5OH"], 1)[0]
 
-    test_case.input['chemical_formula'] = chemical_formula
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
 
+    # Delay solution import until tests can handle static resources:
+    # https://github.com/project-lovelace/lovelace-problems/issues/60
     from problems.solutions.molecular_mass_calculator import molecular_mass
+
+    test_case.input['chemical_formula'] = chemical_formula
     test_case.output['mass'] = molecular_mass(chemical_formula)
 
     return test_case

problems/nand_gate.py

@@ -47,6 +47,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.ONE_ONE:
         p, q = 1, 1
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input["p"], test_case.input["q"] = p, q
     test_case.output["nand"] = NAND(p, q)
 

problems/rock_star_climate.py

@@ -72,21 +72,24 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         a = 1
         ε = PHYSICAL_CONSTANTS['ε_Earth']
 
-    if test_type is TestCaseType.MARS:
+    elif test_type is TestCaseType.MARS:
         S = PHYSICAL_CONSTANTS['S_Mars']
         a = PHYSICAL_CONSTANTS['a_Mars']
         ε = PHYSICAL_CONSTANTS['ε_Mars']
 
-    if test_type is TestCaseType.PLUTO:
+    elif test_type is TestCaseType.PLUTO:
         S = PHYSICAL_CONSTANTS['S_Pluto']
         a = PHYSICAL_CONSTANTS['a_Pluto']
         ε = PHYSICAL_CONSTANTS['ε_Pluto']
 
-    if test_type is TestCaseType.RANDOM:
+    elif test_type is TestCaseType.RANDOM:
         S = uniform(1000, 10000)
         a = uniform(0, 1)
         ε = uniform(0, 1)
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input = {'solar_constant': S, 'albedo': a, 'emissivity': ε}
     test_case.output['T_rock'] = rock_temperature(S, a, ε)
 

problems/rocket_science.py

@@ -71,6 +71,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.RANDOM:
         v = float(uniform(1.0, 100.0, 1)[0])
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['v'] = v
     test_case.output['m_fuel'] = rocket_fuel(v)
 

problems/scientific_temperatures.py

@@ -62,6 +62,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.SUN_SURFACE:
         F = 9940.73
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['F'] = F
     test_case.output['C'] = fahrenheit_to_celsius(F)
     return test_case

problems/sha_256.py

@@ -45,6 +45,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.QUICK_BROWN_FOX:
         M = "The quick brown fox jumps over the lazy dog"
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['message'] = M
     test_case.output['digest'] = SHA256(M)
 

problems/speed_of_light.py

@@ -79,6 +79,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
         c = PHYSICAL_CONSTANTS['c']
         distance = uniform(c, 60*c)
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['distance'] = distance
     test_case.output['time'] = light_time(distance)
 

problems/temperature_variations.py

@@ -77,6 +77,9 @@ def generate_test_case(test_type: TestCaseType) -> ProblemTestCase:
     elif test_type is TestCaseType.SAN_JUAN:
         T = PHYSICAL_CONSTANTS['T']['San Juan, Argentina']
 
+    else:
+        raise ValueError(f"Unrecognized test case: {test_type}")
+
     test_case.input['T'] = T
     test_case.output['T_avg'], test_case.output['T_std'] = temperature_statistics(T)