IPknot for predicting RNA pseudoknot structures using integer programming

Requirements

• Vienna RNA package (>= 2.2.0)
• GNU Linear Programming Kit (>=4.41)

Install

export PKG_CONFIG_PATH=/path/to/viennarna/lib/pkgconfig:$PKG_CONFIG_PATH
mkdir build && cd build
cmake -DCMAKE_BUILD_TYPE=Release .. && make 
make install # optional

Usage

Single sequences

IPknot can take FASTA formatted RNA sequences as input, then predicts their secondary structures including pseudoknots.

% ipknot: [options] fasta
 -h:       show this message
 -t th:    threshold of base-pairing probabilities for each level
 -g gamma: weight for true base-pairs equivalent to -t 1/(gamma+1)
           (default: -g 4 -g 8)
 -e model: probabilistic model (default: McCaskill)
 -b:       output the prediction via BPSEQ format

% ipknot drz_Ppac_1_1.fa
>drz_Ppac_1_1
GACUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGUUGGACACCCACCACUCGCAUUCUUCACCUAUUGUUUAAUUGUGCUUGUGGUGGGUGACUGAGAAACAGUC
.((((((..[[..[[..(((.......)))))))))....((((((((((..((((..((............))..))))..)))))))))).((.....]]))]]

Aligned sequences

IPknot can also take CLUSTAL formatted RNA alignments produced by CLUSTALW and MAFFT, then predicts their common secondary structures.

% clustalw RF00005.fa
% ipknot RF00005.aln
>J01390-1/6861-6
--------CAGGUUAGAGCCAGGUGGUU--AGGCGUCUUGUUUGGGUCAAGAAAUU-GUUAUGUUCGAAUCAUAAUAACCUGA-
........(((((((..(((...........))).(((((.......)))))......(((((.......))))))))))))..

Folding with constraints

IPknot can fold a given sequence or alignment with some constraints. The constraint is given by a 2-columned TSV file. The first column indicates the position i of the base to be constrained. If the second column is given by the number j, this line means a base-pair constraint, that is, ith base and jth base form a base pair. If the second column is respectively given by a character x, |, <, >, the ith base should be unpaired, paired with another base, paired with a downstream base, paired with a upstream base, respectively.

% cat constraint.txt
16 100
41 x
42 x
% ipknot -c constraint.txt drz_Ppac_1_1.fa
>drz_Ppac_1_1
GACUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGUUGGACACCCACCACUCGCAUUCUUCACCUAUUGUUUAAUUGUGCUUGUGGUGGGUGACUGAGAAACAGUC
.........(((((((............((((((((.((.......))))))))))....((((....((........))....))))...........)))))))

This example shows folding with constraints that 16th base and 100th base are paired, 41st and 42nd bases are unpaired.

References

• Sato, K., Kato, Y., Hamada, M., Akutsu, T., Asai, K.: IPknot: fast and accurate prediction of RNA secondary structures with pseudoknots using integer programming, Bioinformatics, 27(13):i85-i93 (Jul. 2011)