Mini-projects

Trying to relearn python and other stuff after long break.

1. DNA sequence analyzer program:

• inputs a dna sequence.
• checks if it is correct.
• gives length, DNA compliment seq, RNA complement seq, GC content, and amount of each bases seperately.

2. FASTA file analyzer:

• inputs a dna sequence name and description
• stores it in a fasta file in this format:

>BRCA1 Homo sapiens breast cancer susceptibility gene
ATGCGTACGTTAGCTAGCTAGCTA

• user can search for a name
• it doesnt allow duplicates
• it also analyzes data (implemented from first project)

3. Gene expression analyzer in a csv:

• This is a gene expression analyzer program. This program can do these tasks:
  • store genes
  • count genes
  • find highest expressed gene
  • find lowest expressed gene
  • average expression
  • search for a gene
  • sort genes by expression
  • cancer vs healthy expression graph
  • compare healthy vs cancer
  • detect upregulated genes
  • threshold filtering

4. DNA Pattern & Motif Finder:

• This program inputs a DNA sequence and do various functions:
  • find motif/pattern
  • Detect palindromic sequences
  • Find repeats
  • Search codons
  • Identify restriction sites

5. Protein Translation Simulator:

• This program inputs a DNA sequence and simulates protein translation:
  • start the translation only after finding start codon
  • stops the function if stop codon is found
  • for searching start codon it uses seperate searching system, where sliding window method is used mimicking original biology
  • after findng start codon the program uses search by 3 step increment
  • gives the final protein like this:

  • The translation of given sequence is:  Methionine - Phenylalanine - Glycine - Glutamic Acid - Histidine