Repository navigation
16S Primers (ChatGPT)
Broad-range 16S primer nomenclature is deceptively non-standard: the same name can refer to different oligonucleotides, while the same oligonucleotide can have different names depending on whether its 5′ or 3′ coordinate was used—for example, 785R/805R and 518R/534R. This matters because even one added degeneracy can materially alter taxonomic recovery; the best-known examples are the successive 515F/806R revisions designed to improve archaeal and SAR11 coverage.
The table below therefore treats sequence, not primer name, as the primary identity, drawing preferentially on original publications and current authoritative resources such as SILVA/TestPrime and the Earth Microbiome Project; it is broad but deliberately not claimed to be exhaustive.
Sequences are reported 5′→3′ as the locus-specific annealing oligonucleotide only; sequencing adapters, sample indices, linkers, and DGGE GC clamps are omitted. "Typical amplicon region" refers to the region obtained in the primer's most common pairing, because an individual forward or reverse primer does not by itself define a V-region amplicon. Numbering conventions are generally based on E. coli 16S rRNA coordinates, but historical papers differ in whether a primer is named for its start or end coordinate, which accounts for several aliases.
IUPAC ambiguity codes appearing below are retained exactly: R=A/G, Y=C/T, M=A/C, K=G/T, W=A/T, S=G/C, H=A/C/T, B=C/G/T, V=A/C/G, D=A/G/T, N=any base. SILVA TestPrime explicitly resolves such IUPAC "wobble" positions when evaluating primer coverage, and its current service cautions that in-silico coverage is a starting point rather than a guarantee of laboratory performance.
| Primer_Name | Primer_Sequence (5′→3′) | Target domain | Typical amplicon region | Common name / aliases / notes | Citation_or_source |
|---|---|---|---|---|---|
| 8F | AGAGTTTGATCCTGGCTCAG |
Bacteria, broad-range | V1–V9 with 1492R; near full length | Eub8F, Eubac8F; effectively the same conserved 5′ bacterial site as the common non-degenerate 27F formulation | DeLong EF. 1992. Archaea in coastal marine environments. PNAS 89:5685–5689; bacterial near-full-length primer sequence shown in the original paper. |
| 27F | AGAGTTTGATCCTGGCTCAG |
Bacteria, broad-range | V1–V9 with 1492R | Eub27F, Eubac27F; non-degenerate form | Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703. DOI 10.1128/JB.173.2.697-703.1991; sequence also explicitly reported by DeLong. |
| 27F | AGAGTTTGATCMTGGCTCAG |
Bacteria, broad-range | V1–V9 with 1492R | Bac27F; M-degenerate modern/Lane-derived form | Widely used Lane-derived formulation; sequence reported in contemporary primer compilations and full-length methods. |
| 27F | GAGTTTGATCMTGGCTCAG |
Bacteria, broad-range | V1–V9 with 1492R | Shortened 27F variant; initial A omitted | Reported as "27f, modified from Lane (1991)" in an Oxford Academic primer table. |
| 63F | CAGGCCTAACACATGCAAGTC |
Bacteria-specific broad-range | Approximately V1–V8 with 1387R; ~1.3 kb | 63f | Marchesi JR, Sato T, Weightman AJ, et al. 1998. Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rRNA. Appl Environ Microbiol 64:795–799. DOI 10.1128/AEM.64.2.795-799.1998. |
| 68F | TNANACATGCAAGTCGRRCG |
Bacteria | V1–V3 with 518R | 68f; heavily degenerate bacterial forward primer | Sequence and evaluation in Thijs S et al. 2017. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys. Front Microbiol 8:494. |
| 338F | ACTCCTACGGGAGGCAGCAG |
Bacteria | Usually V3 or V3–V4 depending reverse primer | Eub338F; bacterial conserved-region primer | Muyzer G, de Waal EC, Uitterlinden AG. 1993. Profiling of complex microbial populations by DGGE analysis of PCR-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700. DOI 10.1128/AEM.59.3.695-700.1993. |
| 341F | CCTACGGGAGGCAGCAG |
Bacteria | V3 with 518R/534R; commonly V3–V4 with a downstream R primer | Classical 341f / Eub341F; non-degenerate DGGE-era form | Muyzer et al. 1993; this primer site subsequently became one of the standard bacterial V3 anchors. |
| 341F | CCTACGGGNGGCWGCAG |
Bacteria | V3–V4 with 785R/805R; ~460 bp | Bakt_341F; SILVA S-D-Bact-0341-b-S-17 | Herlemann DPR et al. 2011. Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. ISME J 5:1571–1579; exact sequence given in the original methods. Klindworth et al. later recommended this site with 785R. |
| 515F | GTGCCAGCMGCCGCGGTAA |
Bacteria + Archaea, broad prokaryotic; known lineage biases | V4 with 806R | 515F-C; original Caporaso/EMP form | Caporaso JG et al. 2011. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS 108:4516–4522; EMP explicitly records this as the original sequence. |
| 515F-Y | GTGYCAGCMGCCGCGGTAA |
Bacteria + Archaea; can also participate in 18S amplification with 926R | V4 with 806R/806RB; V4–V5 with 926R | 515F-Y, 515FB, Parada 515F | Parada AE, Needham DM, Fuhrman JA. 2016. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ Microbiol 18:1403–1414. DOI 10.1111/1462-2920.13023; current EMP form. |
| 518R | ATTACCGCGGCTGCTGG |
Bacteria | V3 with 341F; V1–V3 with upstream forward primers | 518r; sequence is also commonly called 534R because of alternate coordinate naming | Muyzer et al. 1993; exact sequence reproduced in comparative primer tables. |
| 519F | CAGCMGCCGCGGTAA |
Bacteria + Archaea, broad at this conserved site | V4 with 785R; V4–V6 with archaeal downstream primers | Arch519F; SILVA S-D-Arch-0519-a-S-15; short 15-mer formulation | Klindworth et al. evaluated the Arch519F/785R combination as a Bacteria+Archaea pair and reported an average ~278-bp V4 amplicon. |
| 519F | CAGCMGCCGCGGTAANWC |
Broad bacterial/prokaryotic conserved-site primer | Commonly V4 or V4–V5 depending reverse primer | 519f / U519F; longer Lane-derived variant | Explicitly listed as 519f and attributed to Lane (1991) in an Oxford Academic primer table. |
| 534R | ATTACCGCGGCTGCTGG |
Bacteria | V3 with 341F | 534r; same core oligonucleotide frequently called 518R | Frequently used 341F/534R bacterial pair; historical comparison paper identifies 341f/534r as a standard bacterial set. |
| 785R | GACTACHVGGGTATCTAATCC |
Primarily Bacteria; also works in broad Bacteria+Archaea pairing with 519F | V3–V4 with 341F; V4 with 519F | S-D-Bact-0785-a-A-21; sequence also known as Bakt_805R | Klindworth A et al. 2013. Evaluation of general 16S ribosomal RNA gene PCR primers... Nucleic Acids Res 41:e1. DOI 10.1093/nar/gks808; recommended with degenerate 341F for a ~464-bp V3–V4 amplicon. |
| 799F | AACMGGATTAGATACCCKG |
Bacteria; designed/useful for reducing plant chloroplast amplification | V5–V7 with 1193R | 799f | Bodenhausen N, Horton MW, Bergelson J. 2013. Bacterial Communities Associated with the Leaves and the Roots of Arabidopsis thaliana. PLoS ONE 8:e56329; exact sequence and organelle-reduction rationale reported. |
| 805R | GACTACHVGGGTATCTAATCC |
Bacteria, broad-range | V3–V4 with Bakt_341F | Bakt_805R; sequence-equivalent to the commonly named 785R | Herlemann et al. 2011 original sequence. The 805R versus 785R naming difference reflects coordinate convention, not a different oligonucleotide in this formulation. |
| 806R | GGACTACHVGGGTWTCTAAT |
Bacteria + Archaea, broad prokaryotic | V4 with 515F | Original Caporaso 806R | Caporaso et al. 2011; EMP preserves this exact sequence as the original 806R formulation. |
| 806R | GGACTACNVGGGTWTCTAAT |
Bacteria + Archaea, broad prokaryotic | V4 with 515F-Y | 806RB, Apprill 806R, revised 806R | Apprill A, McNally S, Parsons R, Weber L. 2015. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat Microb Ecol 75:129–137. Current EMP sequence. |
| 907R | CCGTCAATTCMTTTGAGTTT |
Bacteria | Commonly V1–V5 with 8F/27F | S-D-Bact-0907-a-A-20 | Klindworth et al. 2013 explicitly tested this formulation with the bacterial 8-site forward primer and documented primer-dependent community bias. |
| 907R | CCGTCAATTCMTTTRAGTTT |
Bacteria | V1–V5 or V4–V5 depending forward primer | 907r; Lane-style degenerate version | Exact sequence listed in an Oxford Academic primer compilation and attributed to Lane (1991). |
| 926F | ACTCAAAGGAATTGACGG |
Broad / "universal" prokaryotic in the cited workflow | V6–V8 with 1392R | 926F, short non-degenerate formulation | Lundberg DS et al. 2012. Defining the core Arabidopsis thaliana root microbiome. Nature 488:86–90; supplementary methods report 926F and universal 1392R. |
| 926F | AAACTYAAAKGAATTGACGG |
Broad prokaryotic | V6–V8 with 1392R; ~0.5 kb | 926F degenerate variant | Exact formulation reported in a widely used 16S methods implementation of the 926F/1392R site. |
| 926F | AAACTYAAAKGAATTGRCGG |
Broad prokaryotic | V6–V8 with 1392R | 926F; R-degenerate variant | Exact sequence reported for 926F/1392R amplicon sequencing and attributed there to Matsuki et al. 2002. |
| 926R | CCGYCAATTYMTTTRAGTTT |
Broad SSU: Bacteria + Archaea; with 515F-Y also amplifies some eukaryotic 18S | V4–V5 with 515F-Y; ~400 bp | 926R, Parada/Fuhrman V4–V5 reverse | Parada, Needham & Fuhrman 2016; exact 515F-Y/926R pair documented in subsequent validation and EMP protocols. |
| 967F | CAACGCGAAGAACCTTACC |
Bacteria | V6–V8 with 1391R; ~424 bp | 967f | Exact 967F/1391R formulation reported in a 2017 microbiome methods study; the pair was also evaluated against SILVA by Thijs et al. |
| 968F | AACGCGAAGAACCTTAC |
Bacteria | V6–V8 with 1401R; ~433–434 bp | 968f; often used with a 5′ GC clamp for DGGE | Nübel U, Engelen B, Felske A, et al. 1996. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. J Bacteriol 178:5636–5643; exact locus-specific sequence reproduced in later applications. |
| 1114F | GCAACGAGCGCAACCC |
Bacteria, broad | V7–V8 with 1392R | 1114F | Exact sequence and pairing with universal 1392R reported by Lundberg et al. 2012; the 1114F/1392R pair is also used in primer-effect studies. |
| 1193R | ACGTCATCCCCACCTTCC |
Bacteria | V5–V7 with 799F | 1193r | Bodenhausen, Horton & Bergelson 2013 reported that 1193R was designed in that study and used it with 799F. |
| 1387R | GGGCGGWGTGTACAAGGC |
Bacteria-specific broad-range | Approximately V1–V8 with 63F | 1387r | Marchesi et al. 1998, original 63F/1387R bacterial primer paper. |
| 1391R | ACGGGCGGTGWGTRC |
Broad conserved reverse site | V6–V8 with 968/967-region forward primers | Uni1391R | Reported in common V6–V8 primer compilations and used with 968F. |
| 1391R | GACGGGCGGTGWGTRCA |
Broad conserved reverse site; bacterial specificity usually imposed by forward primer | V6–V8 with 967F | 1391R, extended formulation | Exact sequence reported with 967F in a 424-bp V6–V8 amplicon protocol. |
| 1392R | ACGGGCGGTGTGTRC |
Broad / prokaryotic "universal" reverse primer | V6–V8 with 926F; V7–V8 with 1114F | Uni1392R; S-*-Univ-1392 family | Exact formulation used with 926F in broad-range sequencing; Klindworth independently evaluated the universal 1392 site for Bacteria+Archaea coverage. |
| 1401R | CGGTGTGTACAAGACCC |
Bacteria | V6–V8 with 968F; ~433 bp | 1401r | Nübel-derived 968F/1401R pair; exact sequence documented in multiple later implementations. |
| 1406R | ACGGGCRGTGWGTRCAA |
Bacteria + Archaea broad reverse site | V6–V8 with B969F; ~438 bp | BA1406R | Comeau AM, Douglas GM, Langille MGI. 2017. Microbiome Helper: a Custom and Streamlined Workflow for Microbiome Research. mSystems 2:e00127-16; the B969F/BA1406R formulation is documented in subsequent method comparisons. |
| 1492R | GGTTACCTTGTTACGACTT |
Broad conserved reverse primer; classically bacterial when paired with 8F/27F | V1–V9 with 8F/27F | Eub1492R, U1492R; common non-degenerate form | DeLong 1992 reports the exact Eubac1492R sequence alongside Eubac27F and archaeal controls. |
| 1492R | GGYTACCTTGTTACGACTT |
Broad conserved reverse site | V1–V9 with 8F/27F | Degenerate 1492r variant | Reported as a modified Lane-derived 1492r in an Oxford Academic primer table. |
| 1492R / rP2 | ACGGCTACCTTGTTACGACTT |
Bacteria, broad-range | Near-full-length V1–V9 with fD1 | rP2; original Weisburg reverse primer gene-specific segment | Weisburg WG et al. 1991, original broad-range near-full-length bacterial PCR method. |
| Arch21F | TTCCGGTTGATCCYGCCGGA |
Archaea-specific | Approximately V1–V5 with Arch958R | Arch21F | DeLong EF. 1992. Archaea in coastal marine environments. PNAS 89:5685–5689. Exact sequence appears in the original paper. |
| Arch349F | GYGCASCAGKCGMGAAW |
Archaea-specific | V3–V4 with Arch806R | Arch349F; S-D-Arch-0349 family | Takai K, Horikoshi K. 2000. Rapid Detection and Quantification of Members of the Archaeal Community by Quantitative PCR Using Fluorogenic Probes. Appl Environ Microbiol 66:5066–5072. |
| Arch806R | GGACTACVSGGGTATCTAAT |
Archaea-specific | V3–V4 with Arch349F | Arch806R | Takai & Horikoshi 2000, exact domain-specific sequence. |
| Arch915R | GTGCTCCCCCGCCAATTCCT |
Archaea-specific | Commonly V4–V5 with Arch519F | Arch915r, 915r | Exact archaeal 915R formulation reported in an Oxford Academic primer table; later comparative work specifically evaluates Arch519F/Arch915R. |
| Arch958R | YCCGGCGTTGAMTCCAATT |
Archaea-specific | Approximately V1–V5 with Arch21F | Arch958R | DeLong 1992; exact sequence shown in the original publication. |
| B969F | ACGCGHNRAACCTTACC |
Primarily Bacteria in common microbiome use | V6–V8 with BA1406R; ~438 bp | B969F | Comeau/Douglas/Langille workflow-associated pair; exact sequence and V6–V8 assignment reproduced in direct primer comparisons. |
| BA1406R | ACGGGCRGTGWGTRCAA |
Broad Bacteria/Archaea reverse primer | V6–V8 with B969F | BA1406R | Comeau et al. 2017-associated V6–V8 pair; exact sequence documented in comparative marine work. |
| Bac349F | AGGCAGCAGTDRGGAAT |
Bacteria-specific | V3–V4 with Bac806R | Bac349F | Takai & Horikoshi 2000, exact bacterial-domain sequence. |
| Bac806R | GGACTACYVGGGTATCTAAT |
Bacteria-specific | V3–V4 with Bac349F | Bac806R | Takai & Horikoshi 2000. |
| Uni340F | CCTACGGGRBGCASCAG |
Prokaryotic universal: Bacteria + Archaea | V3–V4 with Uni806R | Uni340F | Takai & Horikoshi 2000 explicitly described Uni340F/Uni806R as primers for "prokaryotic universal" rDNA. |
| Uni806R | GGACTACNNGGGTATCTAAT |
Prokaryotic universal: Bacteria + Archaea | V3–V4 with Uni340F | Uni806R | Takai & Horikoshi 2000, exact sequence. |
Primer names should not be used as sequence identifiers. The clearest case is 515F/806R: EMP distinguishes the original Caporaso 515F GTGCC... and 806R ...CHV... from the current Parada 515F-Y GTGYC... and Apprill 806R ...CNV...; EMP explicitly warns users to check the actual sequence rather than relying on the primer name.
Likewise, the literature contains multiple 27F, 1492R, 907R, 926F, 519F, and 1391/1392-site formulations, so reporting only "27F/1492R" or "926F/1392R" is not sufficient for reproducibility.
"Universal" should also be read operationally rather than literally. Klindworth et al. evaluated 175 primers and 512 primer-pair combinations against the SILVA SSU reference collection and found large differences in domain and phylum coverage; even their recommended near-full-length bacterial 8/1492 pair had incomplete exact-match coverage, while their 519F/785R combination achieved useful simultaneous Bacteria/Archaea recovery but still missed particular lineages.
SILVA's current TestPrime service remains useful for re-evaluating these sequences against updated rRNA reference data, but SILVA explicitly notes that an in-silico match does not guarantee laboratory amplification.
For current short-read microbiome work, three families dominate different use cases. The 341F/785R–805R V3–V4 family remains a strong bacterial choice and was among the best-performing bacterial pairs in Klindworth's and later SILVA-based comparisons. The 515F-Y/806RB V4 family is the current EMP standard for Bacteria+Archaea, while 515F-Y/926R V4–V5 provides a longer marker and improved representation for several marine groups but can simultaneously recover eukaryotic 18S sequences. For plant tissues, 799F/1193R V5–V7 is often chosen specifically to reduce chloroplast contamination rather than because it is maximally "universal."
The literature through 2026 continues to use these established families rather than converging on a single new universal pair. A 2023 field comparison still directly tested 27F/338R, 341F/785R, 515F/806R, 515F/806RB, 515F-Y/926R, and B969F/BA1406R side by side and found substantial primer-dependent differences, while a 2026 plant dataset continued to use 799F/1193R; current EMP and SILVA infrastructure likewise retain the established primer families.
The timeline highlights seminal papers that introduced, popularized, or substantially revised the principal primer families represented above. The early milestones are anchored by Weisburg, DeLong, Muyzer, Marchesi, and Takai & Horikoshi; the high-throughput era is anchored by Caporaso, Herlemann, Klindworth, Apprill, Parada, and Comeau.
title Key milestones in broad-range 16S primer development and use
1991 : Weisburg et al. — near-full-length bacterial fD1/rP2 PCR
1992 : DeLong — Eubac27F/1492R and Arch21F/Arch958R domain-biased sets
1993 : Muyzer et al. — V3/DGGE bacterial primer era
1996 : Nübel et al. — 968F/1401R V6–V8 family
1998 : Marchesi et al. — bacterium-specific 63F/1387R
2000 : Takai & Horikoshi — Arch/Bac/Uni 349–806 primer families
2011 : Caporaso et al. — 515F/806R V4 high-throughput profiling
: Herlemann et al. — degenerate Bakt_341F/Bakt_805R
2013 : Klindworth et al. — SILVA-wide evaluation of 175 primers and 512 pairs
2015 : Apprill et al. — revised 806R for improved SAR11 recovery
2016 : Parada et al. — 515F-Y and 515F-Y/926R V4–V5
2017 : Comeau et al. — B969F/BA1406R in Microbiome Helper workflow
2026 : EMP and SILVA — established families remain in maintained protocols and evaluation tools
The most consequential historical transition is therefore not the replacement of one "universal" primer by another, but progressive degeneracy and sequence refinement around a small number of conserved 16S binding sites. The current EMP 515F-Y/806RB pair is a particularly clear example: the locus names were retained while specific bases were changed to correct lineage-dependent mismatch bias, reinforcing why exact oligonucleotide sequences should always accompany primer names in methods and metadata.
- Crafted using QIB-GPT test