Repository navigation
metabarcoding primers.md
Based on the primary literature, here is a compiled database of the most commonly used universal 16S rRNA primers, covering full-length amplification (27F/1492R), the classic V1–V3, V3–V4, and V4/V4–V5 regions used in Illumina amplicon sequencing (Earth Microbiome Project standard).
| Primer_Name | Primer_Sequence (5'→3') | Citation_or_source |
|---|---|---|
| 27F (8F) | AGAGTTTGATCMTGGCTCAG | Lane, 1991[1][2] |
| 1492R (long) | GGTTACCTTGTTACGACTT | Turner et al., 1999[2] |
| 1492R (short) | TACCTTGTTACGACTT | Lane, 1991; reevaluated by Frank et al., 2008 (AEM) as the recommended universal form[3][4][2] |
| 1492R (extended, with Y) | TACGGYTACCTTGTTACGACTT | Lane, 1991 (extended variant widely reported in modern PCR protocols)[5][6] |
| 338F | ACTCCTACGGGAGGCAGC | Cited in Sun et al. 16S primer coverage evaluation study[7] |
| 338R | GCTGCCTCCCGTAGGAGT | Cited in Sun et al. 16S primer coverage evaluation study[7] |
| 519F | CAGCMGCCGCGGTAAYAC | Cited in Sun et al. 16S primer coverage evaluation study[7] |
| 519R (536R) | GWATTACCGCGGCKGCTG | Cited in Sun et al. coverage study; paired with 27F for V1–V3 amplicons[7][8] |
| 341F | CCTACGGGNGGCWGCAG | Klindworth et al., 2013, NAR — V3–V4 region[8] |
| 805R | GACTACHVGGGTATCTAATCC | Klindworth et al., 2013, NAR — V3–V4 region[8] |
| 515F (original) | GTGCCAGCMGCCGCGGTAA | Caporaso et al., 2011, PNAS — original Earth Microbiome Project primer[9][10][11] |
| 515F-Y (modified) | GTGYCAGCMGCCGCGGTAA | Parada et al., 2016, Environ. Microbiol. Rep. — corrects Thaumarchaeota bias; current EMP standard[9][11][12] |
| 806R (original) | GGACTACHVGGGTWTCTAAT | Caporaso et al., 2011, PNAS[9][10][11] |
| 806R (modified) | GGACTACNVGGGTWTCTAAT | Apprill et al., 2015, Aquat. Microb. Ecol. — corrects SAR11 bias; current EMP standard[9][11][12] |
| 907R (926R) | CCGTCAATTCMTTTGAGTTT | Cited in Sun et al. coverage study[7] |
| 926R | CCGYCAATTYMTTTRAGTTT | Quince et al., 2011 / Parada et al., 2016 — V4–V5 region reverse primer used with 515F[9] |
| 1390R (1406R) | ACGGGCGGTGTGTRCAA | Cited in Sun et al. coverage study[7] |
| 27f-Bif | AGGGTTCGATTCTGGCTCAG | Frank et al., 2008, AEM — Bifidobacteriaceae-targeted 27F variant[3][4] |
| 27f-Bor | AGAGTTTGATCCTGGCTTAG | Frank et al., 2008, AEM — Borrelia-targeted 27F variant[3][4] |
| 27f-Chl | AGAATTTGATCTTGGTTCAG | Frank et al., 2008, AEM — Chlamydiales-targeted 27F variant[3][4] |
The 27F/1492R pair remains the standard for near-full-length 16S amplification (~1,500 bp) via Sanger or long-read sequencing, though it can cross-amplify plant chloroplast 16S sequences. Frank et al. (2008) specifically re-evaluated 27F and 1492R and found that the shorter 1492R sequence (TACCTTGTTACGACTT) offers better universal coverage than commonly-used longer variants.[3][4][5][13][14]
For short-read Illumina amplicon sequencing, the 515F/806R V4 pair is the de facto standard used by the Earth Microbiome Project, producing a ~300–350 bp product ideal for MiSeq/HiSeq platforms. Note that the "modified" 515F-Y/806R primers (with added degeneracy) are now preferred over the "original" Caporaso versions, since they correct known biases against archaeal Thaumarchaeota/Crenarchaeota and the marine SAR11 bacterial clade.[9][11][15]
The 341F/805R pair targeting V3–V4 is widely used in human microbiome and environmental studies for its balance of taxonomic resolution and Illumina-compatible amplicon length (~460 bp). For V1–V3 amplicons (~500 bp), 27F is commonly paired with 519R instead.[8]
Given the workspace context, this CSV is saved for direct import into your Nextflow/bioinformatics pipelines.
Sources [1] 16S ribosomal RNA - Wikipedia https://en.wikipedia.org/wiki/16S_ribosomal_RNA [2] 16S ribosomal DNA - Lutzoni Lab https://lutzonilab.org/16s-ribosomal-dna/ [3] Critical Evaluation of Two Primers Commonly Used for ... - PMC https://pmc.ncbi.nlm.nih.gov/articles/PMC2293150/ [4] Critical Evaluation of Two Primers Commonly Used for Amplification of Bacterial 16S rRNA Genes https://journals.asm.org/doi/pdf/10.1128/aem.02272-07 [5] Table 1. https://pmc.ncbi.nlm.nih.gov/articles/PMC12905159/table/Tab1/ [6] 1 https://pure.uva.nl/ws/files/2575861/166799_2015_Chronopoulou_etal_oil_bacteria_suppl.pdf [7] Coverage evaluation of universal bacterial primers using the ... - PMC https://pmc.ncbi.nlm.nih.gov/articles/PMC3445835/ [8] Table 1. https://pmc.ncbi.nlm.nih.gov/articles/PMC12684418/table/t0001/ [9] 16S Illumina Amplicon Protocol https://earthmicrobiome.ucsd.edu/protocols-and-standards/16s/ [10] [PDF] Earth Microbiome Project 16S rRNA Amplification Protocol Primers ... https://www.science.smith.edu/cmbs/wp-content/uploads/sites/36/2015/09/Earth-Microbiome-Project.pdf [11] Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal ... https://pmc.ncbi.nlm.nih.gov/articles/PMC5069754/ [12] EMP_16S_V4_515F_806R_Parada_Apprill.xlsx https://earthmicrobiome.org/wp-content/uploads/2022/06/EMP_16S_V4_515F_806R_Parada_Apprill.xlsx [13] [PDF] Cross amplification of 16S rRNA bacterial primer 27F/1492R on ... http://agriculturalscience.unmerbaya.ac.id/index.php/agriscience/article/download/132/149 [14] Table 2. https://pmc.ncbi.nlm.nih.gov/articles/PMC12719267/table/tab2/ [15] [PDF] ARMS Protocols: 14 16S Metabarcoding https://naturalhistory.si.edu/sites/default/files/media/file/arms-1416smetabarcoding.pdf
Primer_Name,Primer_Sequence,Citation_or_source
27F (8F),AGAGTTTGATCMTGGCTCAG,"Lane, 1991 (Nucleic Acid Techniques in Bacterial Systematics)"
1492R (long),GGTTACCTTGTTACGACTT,"Turner et al., 1999 / Lane, 1991"
1492R (short),TACCTTGTTACGACTT,"Lane, 1991; Frank et al., 2008 (AEM)"
1492R (with Y),TACGGYTACCTTGTTACGACTT,"Lane, 1991 (extended version, commonly used)"
338F,ACTCCTACGGGAGGCAGC,"Lane et al., 1985 (cited in coverage evaluation studies)"
338R,GCTGCCTCCCGTAGGAGT,cited in coverage evaluation studies (16S primer coverage papers)
519F,CAGCMGCCGCGGTAAYAC,cited in coverage evaluation studies (16S primer coverage papers)
519R (536R),GWATTACCGCGGCKGCTG,cited in coverage evaluation studies; used for V1-V3 region with 27F
341F,CCTACGGGNGGCWGCAG,"Klindworth et al., 2013 (Nucleic Acids Research) - V3-V4 region"
805R,GACTACHVGGGTATCTAATCC,"Klindworth et al., 2013 (Nucleic Acids Research) - V3-V4 region"
"515F (Caporaso, original)",GTGCCAGCMGCCGCGGTAA,"Caporaso et al., 2011, PNAS - Earth Microbiome Project"
"515F-Y (Parada, modified)",GTGYCAGCMGCCGCGGTAA,"Parada et al., 2016, Environ Microbiol Rep - EMP standard"
"806R (Caporaso, original)",GGACTACHVGGGTWTCTAAT,"Caporaso et al., 2011, PNAS - Earth Microbiome Project"
"806R (Apprill, modified)",GGACTACNVGGGTWTCTAAT,"Apprill et al., 2015, Aquat Microb Ecol - EMP standard, corrects SAR11 bias"
907R (926R),CCGTCAATTCMTTTGAGTTT,cited in coverage evaluation studies; used for V4-V5 region with 515F
926R,CCGYCAATTYMTTTRAGTTT,"Quince et al., 2011 / Parada et al., 2016 - V4-V5 region reverse primer"
1390R (1406R),ACGGGCGGTGTGTRCAA,cited in coverage evaluation studies (16S primer coverage papers)
27f-Bif,AGGGTTCGATTCTGGCTCAG,"Frank et al., 2008, AEM - Bifidobacteriaceae-specific 27f variant"
27f-Bor,AGAGTTTGATCCTGGCTTAG,"Frank et al., 2008, AEM - Borrelia-specific 27f variant"
27f-Chl,AGAATTTGATCTTGGTTCAG,"Frank et al., 2008, AEM - Chlamydiales-specific 27f variant"