Lowercase entries in gfa file are not reported in variant calling

[Chris7]

1. What were you trying to do?
Get the read depth of alternative paths via vg call

2. What did you want to happen?
Read depth of alignments to be reported

3. What actually happened?
If an alternative path was defined in lowercase, the reads were not included in the allele depth support.

5. What data and command can the vg dev team use to make the problem happen?

simple gfa

H	VN:Z:1.2
S	1	AACTCCGAATTCCTCCGACAAGTCGGTAC	SN:Z:g1-Chr1	SO:i:0	SR:i:0
S	2	CGA	SN:Z:g1-Chr1	SO:i:29	SR:i:0
S	3	CCTCTTCCGGCGGAGAATATATATGAACA	SN:Z:g1-Chr1	SO:i:32	SR:i:0
L	1	+	2	+	*
L	2	+	3	+	*
W	genome	1	g1-Chr1	0	3	>1>2>3	*
S	4	ggt	SN:Z:g2-Chr1	SO:i:29	SR:i:1
L	1	+	4	+	*
L	4	+	3	+	*
W	genome	1	g2-Chr1	0	3	>1>4>3	*

vg convert -g lowercase_bug.gfa -v > simple.vg
vg index -g simple.gcsa -x simple.xg -L simple.vg
# this sequence has `GGT` in it and will not be reported in the allele depth. If `ggt` is made `GGT` in the above GFA, it will be counted
vg map -x simple.xg -g simple.gcsa -s AACTCCGAATTCCTCCGACAAGTCGGTACGGTCCTCTTCCGGCGGAGAATATATATGAACA  --threads 6 > simple.gam
vg gamsort simple.gam > simple.sorted.gam
vg index -l simple.sorted.gam
vg pack -e -x simple.vg -g simple.sorted.gam -o simple.pack -t 9 -s 0
vg call -k simple.pack simple.vg -a -A  > simple.vcf
cat simple.vcf

6. What does running vg version say?

vg version v1.46.0 "Altamura"
Compiled with g++ (Ubuntu 10.3.0-1ubuntu1~20.04) 10.3.0 on Linux
Linked against libstd++ 20210408
Built by xian@octo

[glennhickey]

Avoid using convert -v. You can either use vg convert -p instead or, even better, vg autoindex -g lowercase_bug.gfa -w map -p simple to make the xg and gcsa in one shot.

[Chris7]

Thanks, is this just something not supported in -v? I'm not sure how one would know this information ahead of time and if there are some better resources for reading up on this.

[Chris7]

Is this the cause of this as well? #3766

[glennhickey]

The underlying issue is that the compressed vg formats (gbwt, gbz, xg, and packed-graph) don't use enough bits per base to keep track of whether its softmasked or not. When you convert from GFA with vg convert the lower case bases are made upper case as-needed to store in the compressed format (which is probably the best way to handle them).

But, apparently from what you show, when you run vg index -g on the protobuf-formatted vg (which does support lower-case bases), it looks like they are instead getting lost, which looks like a bug that we should fix. Still, your best bet even once it's fixed is to avoid the protobuf format entirel.y