Skip to content
Martin Asser Hansen edited this page Oct 1, 2015 · 16 revisions

#summary A collection of Howtos #labels Featured

Biopieces setup and test

Howto update Biopieces

Biopieces are continuously updated, and it is highly recommended to keep your own version up to date, since there is no such thing as stable releases. Updating Biopieces is a two step process where the code and the wiki is updated separately using subversion. There is an alias for this so simply run the following command:

bp_update

Howto test Biopieces

Biopieces comes with a testing suite for testing all (well, only a few for now) Biopieces with all the different options (in a perfect world). Run the following command to test your installation:

bp_test

Howto setup default MySQL username and password

Biopieces can read configuration information from the ~/.biopiecesrc file. The information in the file is written as a single Biopiece record, that with respect to default MySQL settings look like this:

MYSQL_USER: Martin
MYSQL_PASSWORD: Swordfish
---

So, in order to allow the different Biopieces to access the MySQL database to read default username and password settings - so you don't have to type these out everytime you run one of these Biopieces - edit the ~/.biopiecesrc on your system with your favorite editor, and enter an entry like the above and modify the MYSQL_USER and MYSQL_PASSWORD. Finally save the file and change the permissioins on the file so other users cannot see your password:

chmod 600 ~/.biopiecesrc

Trouble shooting

Howto trouble shoot a Biopieces pipe

If you have a Biopieces pipe that fails there can be a number of different reasons:

  • Most often it is misuse where the upstream Biopiece is e.g. outputting the keys S_ID and Q_ID and the downstream Biopiece is expecting the key SEQ_NAME.
  • Another catagory of common mistakes is bad data where an empty sequence or a sequence with UIPAC ambiguity codes are used with an external tool that disallow these like uclust.
  • Also, it is possible that the data input is truncated or was formatted with carriage returns (i.e. files from Windows).
  • There is also computer errors where memory or disk space ran out.
  • Finally, you may have encountered a bug in Biopieces - see further down in this section.

In order to locate the error do the following:

  1. Read the error message carefully - perhaps you forgot a mandatory option or a file was not found.
  2. Read the wiki pages for the used Biopieces carefully.
  3. Retry with a few records to minimize the time it takes to reproduce the error. Use the --num switch with [read_<format>].
  4. Retry with the --verbose switch to get more information - mostly for wrappers like [blast_seq], etc.
  5. Verify the input file format e.g. FASTA and FASTQ can be mistaken.
  6. Verify the input file's line delimiter i.e. Windows generated text files may have bad line seperators.
  7. Isolate your problem by dividing the pipe in two and run each seperately. See [Howto write the data stream to file]
  8. Repeat 7 for each half.
  9. Inspect the data stream after each Biopiece in the pipe to verify it contains what you expect.

If the error is not reproducable with a small data set (i.e. using a few records), then there is most likely a problem with the data, like a truncated input file or a missing sequence - or with computer resources like memory or disk space.

If you believe, you have found a bug in Biopieces please report here and please give a reproducable example with a minimal data set.

Record manipulations

Howto select records from the stream matching a list of identifiers

Often you need to select records from the stream that matches a list of e.g. sequence names. In order to do this we need [grab] and a file with a list of identifiers - one per line - that matches exactly a key in the stream. So to extract particular sequences from e.g. the below FASTA file in the file test.fna ...

>HA8CWBL01B9XZN
ACGAGTGCGTCCTACGGGAGGCAGCAGTGGGGAATCTTCC
>HA8CWBL01AI903
ATAGAGTACTCCTACGGGGCGCAGCAGTGGGGAATCTTCC
>HA8CWBL01CUX4D
ACGAGTGCGTCCTACGGGGTGCAGCAGTGGGGAATCTTCC
>HA8CWBL01CUSUJ
TGTGAGTAGTCCTATGGGATGCAGCAGTGGGGAATCTTCC
>HA8CWBL01AT53B
CGTCTAGTACCCTACGGGAGGCAGCAGTGGGGAATCTTCC
>HA8CWBL01CERKQ
ACGAGTGCGTCCTACGGGGGGCAGCAGTGGGGAATCTTCC
>HA8CWBL01C382Z
TGTGAGTGGTCCTACGGGACGCAGCAGTGGGGAATCTTCC
>HA8CWBL01AR4X0
TAGTGTAGATCCTACGGGATGCAGCAGTGGGGAATCTTCC
>HA8CWBL01A35I4
ACGAGTGCGTCCTATGGGGTGCAGCAGTGGGGAATCTTCC
>HA8CWBL01C29XM
ACGCGAGTATCCTATGGGAGGCAGCAGTGGGGAATCTTCC

... wanting the records where the SEQ_NAME matches the identifiers in the file test.id:

HA8CWBL01CUX4D
HA8CWBL01AR4X0
HA8CWBL01CUSUJ
HA8CWBL01C29XM
HA8CWBL01A35I4

We simply do:

read_fasta -i test.fna | grab -E test.id -k SEQ_NAME ...

Sequence manipulations

Howto turn FASTQ files into FASTA files

This is easily done using [read_fastq]. Basically, any entries that contain a SEQ_NAME and SEQ keys can be written to FASTA files using [write_fasta] yields these keys, the conversion is pretty trivial:

read_fastq -i data.fq | write_fasta -o data.fq -x

Howto turn FASTA files into FASTQ files

In order to do this you need to add quality SCORES. This might not be a good idea since you are probably going to feed this bogus quality score data to downstream software that is tuned for real-life data. However, you can simply add quality SCORES using [compute] to yield a specified score :

read_fasta -i data.fna |
compute -e 'SCORES="I" x SEQ_LEN' |
write_fastq -o data.fq -x

Sequence search

Howto map short sequences

Mapping short sequences to a reference is a two-step process which involves first the indexing of the reference, and second the mapping itself. Biopieces contains wrappers for a number of different short sequence mappers:

  • [bowtie_seq]
  • [bwa_seq]
  • [usearch_seq]
  • [vmatch_seq]

And their respective indexing tools:

  • [create_bowtie_index]
  • [create_bwa_index]
  • create_usearch_index (not ready yet)
  • [create_vmatch_index]

All of the above pretty much have the same options so it is simply:

read_fasta -i reference.fna |
create_<bowtie|bwa|vmatch>_index -d <directory> -i <index name> -x

The index files will be prefixed with <index name> and then put into the specified <directory>, which is craeated for the occation.

To map sequences against the index we simply do:

read_fasta -i data.fna |
<bowtie|bwa|vmatch>_seq -i <index name> |
write_bed -o result.bed -x

And the result will be written in BED format. Other formats can be used as well.

Howto search with long sequences

BLAT and BLAST are very useful tools for searching long sequences. Biopiece wrappers are available for both:

  • [blat_seq]
  • [blast_seq]

[blat_seq] don't require an index, so we can simply do:

read_fasta -i data.fna |
blat_seq -d reference.fna |
write_psl -o result.psl -x

And the result will be written in PSL format. Other formats can be used as well.

BLAST requires an indexed reference sequence and are index in a similar was to the indexes described in [Howto map short sequences].

So for BLAST we do:

read_fasta -i reference.fna |
create_blast_index -d <directory> -i <index name> -x
read_fasta -i data.fna |
blast_seq -d <index name> |
write_bed -o result.bed -x

Howto pick best BLAST hits

It is possible to pick the top-5 BLAST hits for each query in a multi-sequence search using [index_vals]. Below we read in BLAST output saved in tabular format and use [index_vals] to add an index/forth-running number to each Q_ID in the file. Since BLAST per default outputs the results sorted so the best hits are output first we can then subsequently use [grab] to pick the first/best 5 hits:

read_blast_tab -i in.blast |
index_vals -k Q_ID |
grab -e 'Q_ID_INDEX <= 5' |
write_blast -o out.blast -x

Howto search for patterns

Searching for patterns is best done with [patscan_seq] which is a wrapper around scan_for_matches, the best pattern scanning software ever. Patterns can be designed carefully allowing ambiguity codes, mismatches, insertions, and deletions as well as stem loops (nucleotides only). So basically we can do:

read_fasta -i data.fna |
patscan_seq -p <pattern> |
write_bed -o result.bed -x

And the result is written to a BED file.

Now, the pattern can be simple such as a seqeunce: ATCG Or a more complex pattern like a stem capped by a tetra-loop p1=ATCG 4...4 ~p1[1,0,0] where the one strand of the stem is ATCG and is assigned to pattern 1 (p1), then followed by a range of four unspecified residues and finally the reverse complement of p1 allowing for 1 mismatch, 0 insertions and 0 deletions.

Quality assurance and cleaning NGS data

Howto get some basic sequence statistics

So you have a brand new sequence data set and want to get an overview ...

The first thing is to figure out what type of file format the data is store in. FASTA data are typically stored in files with .fna, .fa, .faa, or .fasta suffixes and these can be read using [read_fasta]. FASTQ files typically have .fq or .fastq suffixes and can be read using [read_fastq]. Data from Roches's 454 platform can come as SFF with .sff suffix and can be read with [read_sff], but can also come in two files, one a FASTA file with the sequence and a FASTA like file with the quality scores. These can be read with [read_454]. And now to the basic questions:

To find out how many sequences you have use [count_records]:

read_fasta -i data.fna | count_records -x

Which will output a record with the sequence count:

RECORDS_COUNT: 12345678
---

A bit more advanced which in addtion to record count will tell you the minimum, maximum and mean sequence lengths among other things:

read_fasta -i data.fna | analyze_vals -x | write_tab -cCpx

Then you get a table like this:

+----------+------------+--------+-----+-------+-----------+-------+
| KEY      | TYPE       | COUNT  | MIN | MAX   | SUM       | MEAN  |
+----------+------------+--------+-----+-------+-----------+-------+
| SEQ_NAME | Alphabetic | 10,000 |  37 |    41 |   398,895 | 39.89 |
| SEQ      | Alphabetic | 10,000 | 120 | 1,108 | 4,810,958 | 481.1 |
| SEQ_LEN  | Numeric    | 10,000 | 120 | 1,108 | 4,810,958 | 481.1 |
+----------+------------+--------+-----+-------+-----------+-------+

Which is basically the output of these Biopieces:

  • [mean_vals]
  • [median_vals]
  • [sum_vals]
  • [max_vals]
  • [min_vals]

If you want to analyze the sequence composition you can use [analyze_seq] which will yield the residue composition, and the percentages of how many residues are soft masked (i.e. lower case) and hard masked (i.e. N's), and the GC%.

SEQ_NAME: ILLUMINA-52179E_0004:2:1:1040:5263#TTAGGC/1
SEQ: TTCGGCATCGGCGGCGACGTTGGCGGCGGGGCCGGGCGGGTCGANNNCAT
SEQ_LEN: 50
RES[T]: 7
RES[C]: 13
RES[G]: 23
RES[A]: 4
RES[N]: 3
SOFT_MASK%: 0.0
HARD_MASK%: 6.0
GC%: 72.0
---

Thus to get the mean HARD_MASK% for all records in the stream, you need to use [analyze_seq] followed by [mean_vals] like this:

read_fasta -i data.fna |
analyze_seq |
mean_vals -k HARD_MASK% -x

Which outputs the mean in a record like this:

HARD_MASK%_MEAN: 3.80
REC_TYPE: MEAN
---

See also [Howto determine the GC content of a data set].

Howto plot the length distribution of a data set

Plotting the length distribution of a data set involves reading in the data and piping it into [plot_distribution]:

read_fasta -i data.fna |
plot_distribution -k SEQ_LEN -t png -o plot.png -x

And the plots look like this:

Howto plot the nucleotide distribution of a data set

It is possible to detect problems with the nucleotide distribution of shotgun sequence data using [plot_nucleotide_distribution]:

read_fastq -i data.fq |
plot_nucleotide_distribution -t png -o plot.png -x

And the plots look like this:

Howto determine the GC content of a data set

To get the mean GC content of a sequence you can use [analyze_gc], and if you want the mean GC content for a stack of sequences you simply calculate the mean using [mean_vals]:

read_fasta -i data.fna |
analyze_gc |
mean_vals -k GC% -x

Which will output a record with the mean GC content:

GC%_MEAN: 37.50
---

A distribution of the GC content can be created like this:

read_fasta -i test.fna |
analyze_gc |
bin_vals -b 5 -k GC% |
plot_distribution -k GC%_BIN -o gc_dist_plot.png -t png -x

To get the following plot:

Howto collect several sequence files

With the comming of the Illumina HiSeq platform the sequence data from each experiment may come as multiple files. These can be collected like this:

read_fastq -i ‘experiment_X_*.fastq.gz’ |
write_fastq -Zo experiment_X_all.fq.gz -x

Notice that we keep the data zipped to avoid filling up the disks unnecessarily.

Howto filter sequences on length

To filter sequences where the length is outside a given interval e.g. 100-200, we can use [grab] twice:

read_fastq -i in.fq |
grab -e 'SEQ_LEN >= 100' |
grab -e 'SEQ_LEN <= 200 |
write_fastq -o out.fq -x

Howto remove filtered sequences from Illumina HiSeq data

Some sequences have suboptimal quality scores and have been flagged as filtered by the CASAVA 1.8 pipeline. These contain a Y in the sequence name as in "filtered? Yes!". We need to remove these like this:

read_fastq -i data.fq.gz | 
grab -ip ':Y:' -k SEQ_NAME | 
write_fastq -Zo data_filt.fq.gz -x

It is probably a good idea to check how many sequences were filtered. Use [count_records] for that.

Howto split a NGS data set according to barcodes

Barcodes are DNA tags of 6-11 bases that are added to experiements allowing for simultaniously sequencing of multiple experiments, which can then be seperated after sequencing based on the barcodes. Splitting a NGS data set on DNA barcodes can be done by reading the data followed by [find_barcodes] to locate (and remove) the barcodes, and finally, write the sequences to files according to the barcode name with [write_fasta_files] like this:

read_sff -i data.sff |      # Read the data from a SFF file
find_barcodes -p 4 -m 2 |   # Look for barcode at position 4 and allow for 2 mismatches
write_fasta_files -d Output_dir -k BARCODE_NAME -x   # Write FASTA files 

And the resulting files will end up in the Output_dir:

Output_dir/
|-- MID1.fasta
|-- MID10.fasta
|-- MID104.fasta
|-- MID106.fasta
|-- MID107.fasta
|-- MID109.fasta
...

In the above example we are looking for Roche's MID barcodes, which are hard coded in find_barcodes. It is possible to use a list of custom barcodes ).

It is possible to start with FASTA and QUAL files using [read_454], and it is possible to preserve the quality scores by saving the output in FASTQ format using [write_fastq_files].

Howto plot quality scores

Plot the mean quality score using [plot_scores] like this:

read_fastq -i data.fq.gz |
plot_scores -t png -o data_scores.png -x

This will output a PNG file with the mean scores:

Howto trim sequence ends

Since the quality scores of the sequences deteriorate with sequence length, we need to trim sequences from the ends that have suboptimal quality scores. We do this pretty conservatively by using the threshold Q20 with [trim_seq]. Also, since some sequences will be trimmed down to length 0, we need to filter these ) an only keep sequences of a minimum length:

read_fastq -i data.fq.gz |
trim_seq -m 20 |
grab -e ‘SEQ_LEN>=50’|
write_fastq -Zo data_etrim.fq.gz -x

Howto identify quality scores with local minima

Some sequences may contain a region with suboptimal sequence after end trimming (see [Howto trim sequence ends]). These can be identified by running a sliding window over the sequence to locate local minima, and if any such is found, the sequence can be discarded. We use [mean_scores]:

read_fastq -i Ex1_filt_etrim.fq.gz |
mean_scores -l |
grab -e ‘SCORES_MEAN_LOCAL >= 15’ |
write_fastq -Zo Ex1_filt_etrim_ltrim.fq.gz -x

Do count how many sequences were filtered using [count_records]. Also you can plot the mean scores. See [Howto plot quality scores].

Howto remove adaptors and adaptor parts from reads

Adaptors can be located with [find_adaptor] that scan sequences for given adaptor sequences allowing for a specified percentage of mismatches, insertions and deletions. It can also locate partial adaptors that are often found at the sequence ends. Next the located adaptors can be removed with [clip_adaptor].

read_fastq -i test.fq |
find_adaptor -l 1 -L 1 -f ACACGACGCTCTTCCGATCT -r TCTAGCCTTCTGTGTGCAGA |
clip_adaptor |
write_fastq -o test_noAdaptor.fq -x

Howto interleave pair-end sequences

Pair-end sequences are generally output in correct order from the sequencing instruments, and to maintain that order with Biopieces it is possible to read in the data from two list of files using [read_fastq]:

read_fastq -i pair1.fq -j pair2.fq |
write_fastq -o interleaved.fq

Interleaved records in the stream are required for assembly with [assemble_pairs], and [assemble_seq_velvet], etc.

If, for some reason, the order of pairs is lost it is possible to restore the order with [order_pairs], however, it is much more efficient - time and memory wise - to make sure the original order is kept.

Howto clean pair-end sequences

Cleaning pair-end sequences is a two step process:

  1. Interleaving sequence ).
  2. Actual trimming and filtering.

The trimming part involves end-trimming and adaptor removal, while the filtering part utilizes a trick where the paired sequences are merged into a single sequence while the length of the left and right sequence is recorded. Thus, it is possible to filter on the left or right seqeunce length and, in the merged sequence, filter sequences with local areas of suboptimal quality. Finally, the merged sequences are split and:

read_fastq -i interleaved.fq | 
trim_seq -m 25 -l 3 |
find_adaptor -l 6 -L 6 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTC |
clip_adaptor |
merge_pair_seq |
grab -e 'SEQ_LEN_LEFT >= 30' |
grab -e 'SEQ_LEN_RIGHT >= 30' |
mean_scores -l |
grab -e 'MEAN_SCORE_LOCAL >= 15' |
split_pair_seq |
write_fastq -o cleaned.fq -x

See also [Example processing pair-end FASTQ files].

De novo assembly

Assembly is the art of stitching together short sequences into longer contig -uous regions. Genome assembly without a reference to use as backbone is called de novo assembly. De novo assembly using 454 reads should be done with Newbler and MIRA for the best results.

Howto do genome assembly

Illumina reads can be assembled using the following Biopieces which are basic wrappers:

  • [assemble_seq_velvet]
  • [assemble_seq_idba]
  • [assemble_seq_ray]

There is no single best way of performing genome assembly, so it is recommended to do a number of assemblies with different filtering and assemblers and compare the results. The assembler Biopieces do multiple assemblies with a range of different parameters, like k-mer sizes. Also, the starting data may or may not benefit from rigorously trimming and cleaning.

So for all of the assemblers you can do this:

read_fastq -i data.fq.gz |
assemble_seq_<assembler> -d <directory> -k <min k-mer size> -K <max k-mer size> |
write_fasta -o contigs.fna -x

The [assemble_seq_velvet] will produce a number of assemblies that will be stored in the <directory> and only the best assembly - determined from the highest N50 - will be output to the stream and stored in the FASTA file. [assemble_seq_idba] is iterative and only outputs the best assembly.

The result of the assemblies can be evaluated using [analyze_assembly] (see [Howto analyze assembled contigs]).

Howto do meta-genome assembly

Assembly is done using Meta-IDBA.

read_fastq -i Ex1_filt_etrim_ltrim.fq.gz |
assemble_seq_idba -m -k 50 -K 80 -d IDBA |
write_fasta -Zo Ex1_assembly.fna.gz

metavelvet - needs to be studies (probably in Japanese).

Howto analyze assembled contigs

Assembled contigs can be analyzed to get some stats using [analyze_assembly]. We include a filtering step to discard contigs shorter than 200 bases:

read_fasta -i contigs.fna |
grab -e "SEQ_LEN>=200" |
analyze_assembly -x

And the output:

N50: 9082
MAX: 52038
MIN: 200
MEAN: 4170
TOTAL: 3057214
COUNT: 733
---

Notice that with the -g switch [analyze_seq] will calculate a predicted gene coverage that is a useful metric for comparing multiple assemblies.

Finding SNPs and DIPs

Howto find SNPs and DIPs

Many different tools exists for calling single nucleotide polymorphims (SNP) and deletion/insertion polymophisms (DIP). Basically, these work by mapping sequences to a reference and do advanced statistics on the descrepancies. Sometimes, this is follwed by realignment sequences around the positions of interest - and more statistics. Biopieces have a naive step-wise method which focusses on rigorous trimming and cleaning of sequnces to minimize the impact of SNPs and DIPs caused by residues with substandard quality. So the steps are:

  1. Trim sequences ).
  2. Filter sequences with substandard qualities ).
  3. Map sequences to reference ).
  4. [find_SNPs]

SNPs and DIPs can be found in KISS or SAM type records using [find_SNPs]:

read_sam -i mapping_result.sam |
find_SNPs |
grab -e "REC_TYPE eq SNP" |
sort_records -rk SNP_COUNTn |
write_tab -cx 

Which will yield a table outlined below, from where it is easy to distinguish real SNPs from the SNP_COUNT alone:

#SNP_COUNT      EVENT   S_ID    REC_TYPE        TYPE    POS
65      T>G     gi|48994873|gb|U00096.2|        SNP     MISMATCH        2500
62      G>-     gi|48994873|gb|U00096.2|        SNP     DELETION        7000
57      T>A     gi|48994873|gb|U00096.2|        SNP     MISMATCH        2000
55      C>A     gi|48994873|gb|U00096.2|        SNP     MISMATCH        1500
51      G>C     gi|48994873|gb|U00096.2|        SNP     MISMATCH        1000
49      G>-     gi|48994873|gb|U00096.2|        SNP     DELETION        7500
48      T>G     gi|48994873|gb|U00096.2|        SNP     MISMATCH        500
43      ->A     gi|48994873|gb|U00096.2|        SNP     INSERTION       3500
36      ->A     gi|48994873|gb|U00096.2|        SNP     INSERTION       2999
4       T>A     gi|48994873|gb|U00096.2|        SNP     MISMATCH        3499

Annotating sequences

Howto find ORFs

[find_genes]

Advanced Biopiece use

Howto write the data stream to file

All Biopieces write the data stream to 'stdout' by default which can be written to a file by using the ubiquitous -O switch:

<biopiece> -O <file>

It is also possible to use redirection <biopiece> > <file>, but beware that if the biopiece outputs data e.g. FASTA entries then the FASTA data and Biopiece data will be mixed and causing havock.

Howto read the data stream from file

If you want to read a data stream that you previously have saved to file in Biopieces format (see [Howto write the data stream to file]) do:

<biopiece> -I <file>

This switch works with all Biopieces. It is also possible to read in data from multiple sources by repeating:

<biopiece> -I <file1> | <biopiece> -I <file2>

It is also possible to use a glob expression:

<biopiece> -I "*.stream"

Note that the glob expression must be in "".

It is also possible to use redirection with cat <file> | <biopiece> or <biopiece> < <file>.

Howto read data from multiple sources

It is also possible to read in a saved Biopieces stream ) as well as reading data in one go:

<biopiece> --stream_in=<file1> --data_in=<file2>

If you want to read data from several files you can do this:

<biopiece> --data_in=<file1> | <biopiece> --data_in=<file2>

If you have several data files you can read in all explicitly with a comma separated list:

<biopiece> --data_in=file1,file2,file3

And it is also possible to use file globbing:

<biopiece> --data_in="*.fna"

Or in a combination:

<biopiece> --data_in="file1,/dir/*.fna"

Finally, it is possible to read in data in different formats using the appropriate Biopiece for each format:

<biopiece1> --data_in=<file1> | <biopiece2> --data_in=<file2> ...

Howto loop Biopieces

It is possible to utilize the bash shell to loop over multiple input files. If for an example you have multiple experiments each in one FASTA file, and you for all the files want to obtain the sequences longer than 100 in a new file, you can do:

for i in *.fna;
  do read_fasta -i $i | grab -e 'SEQ_LEN>=100' | write_fasta -o `basename $i .fna`._gt100.fna -x;
done

Notice that we use the shell tool basename to rename the output files from my_experiment.fna to my_experiment_gt100.fna.

Howto alias Biopieces

You can make aliases to popular commands to save time typing:

alias revcomp_seq="reverse_seq | complement_seq"

Which makes it possible to reverse-complement sequences like this:

read_fasta -i data.fna | revcomp_seq | write_fasta -o data_rc.fna -x

You can also use aliases as shortcuts to Biopieces with specific arguments which saves typing:

alias blast_refseq="blast_seq -d /var/databases/blast/refseq"

To save aliases from session to session save these in your .bashrc file.

Howto script Biopieces

Often you get a pipeline that is quite long and to avoid re-typing the commands and avoid the hazzle of copy/pasting across several lines the easy way is to put the pipeline in a shell script. To do this, open a text file with your favorite text editor and enter something like this:

#!/bin/sh

read_fasta -i HPV.fna |      # read in the Human Papilloma Virus genome
add_ident -k SEQ_NAME |      # add a new identifier to all sequences
indel_seq -i 1 -d 1 |        # add 1 insertions and 1 indel to each sequence
mutate_seq -n 1 |            # mutate 1 residue in the sequence
write_fasta -o HPV_mutant -x # write sequences to file.

The first line #!/bin/sh is the hashbang or shebang line that tells the operating system that this file should be interpreted with the sh or shell command. Note that you can have comments in the Biopiece script using #. After saving the file (here we saved it as test.sh) you can change the permissions on the file to make it executable so it may be run from the commandline:

chmod "+x" test.sh

./test.sh

Another use for scripting Biopieces is to get a clear seperation of Biopieces code and everything else. Such a script would be reading raw data of a particular format from STDIN and write raw data of a particular format to STDOUT. E.g.

#!/bin/sh

read_fastq -i - |             # read raw FASTQ data from STDIN
grab -ip ':Y:' -k SEQ_NAME |  # Grab all records wihtout :Y: in the sequence name
write_fastq -x                # write raw FASTQ data to STDOUT

Now this can be executed from the command line and we observed that the Biopieces part is abstracted away:

cat data_in.fq | ./test.sh > data_out.fq

Howto to use complex Biopiece records

Biopiece records are based on hash type structures with key/value pairs on separate lines (terminated with a newline or \n) using : (colon followed by a white space) to assign the right side value to the left side key: key: value. Records are delimited by lines of ---. This simple type of records has a number of significant advantages over more complex hierarchical structures such as YAML or XML:

  1. speed Biopiece records are much faster to parse and emit than more complex data types.
  2. simplicity a simple type of data record is more understandable for users, and easier to manipulate for developers, remember that not everyone is an expert programmer.
  3. compatibility simple records allow for easy compatability between Biopieces, but also with standard UNIX tools, sed, and awk.

However, since there are very little restaints in the Biopiece format, it is possible to use complex records by serializing the data into strings.

One example of complex data that is used in a number of Biopieces are a list of elements, such as the quality SCORES in [read_fastq]:

SCORES: 40;40;40;40;40;40;40;40;40;40;40;40

This is simply a list of scores seperated by a delimiter that in this case is ; and which easily can be used to split the different values. There is no restraints as to how a simple list like this is defined. It could be in brackets and separated by commas to follow the Perl data structure syntax, or it could be something completely different - it is up to the Biopieces that manipulates the relevant data.

If you as an example want to use a list of lists you can assign it to a Biopiece records as demonstrated with this table:

A1  B1  C1
A2  B2  C2
A3  B3  C3

Which can be written as a Biopiece record like this:

cat test.stream

TABLE: [ [ 'A1', 'B1', 'C1' ], [ 'A2', 'B2', 'C2' ], [ 'A3', 'B3', 'C3' ] ]
---

Now, this way of serializing the table is based on Perl data structures where [] denotes a list of comma separated elements, and embedded [[],[],[]] denotes a list of lists. The advantages here is that we can use Perl's eval command to allow the Perl parser to quickly translate the string to a Perl data structure. We do this with [bioscript]:

bioscript -I test.stream -e '$r = get_record( $in ); $r->{ TABLE2 } = eval $r->{ TABLE }; print Dumper( $r )'

$VAR1 = {
          'TABLE' => '[ [ \'A1\', \'B1\', \'C1\' ], [ \'A2\', \'B2\', \'C2\' ], [ \'A3\', \'B3\', \'C3\' ] ]',
          'TABLE2' => [
                        [
                          'A1',
                          'B1',
                          'C1'
                        ],
                        [
                          'A2',
                          'B2',
                          'C2'
                        ],
                        [
                          'A3',
                          'B3',
                          'C3'
                        ]
                      ]
        };

As you can see, TABLE2 contains the eval'ed data which now can be manipulated the Perl way.

Of cause we cauld have done the eval in place and thus avoid creating a TABLE2 key:

bioscript -I test.stream -e '$r = get_record( $in ); $r->{ TABLE } = eval $r->{ TABLE }; print Dumper( $r )'

$VAR1 = {
          'TABLE' => [
                        [
                          'A1',
                          'B1',
                          'C1'
                        ],
                        [
                          'A2',
                          'B2',
                          'C2'
                        ],
                        [
                          'A3',
                          'B3',
                          'C3'
                        ]
                      ]
        };

Similarly, different XML or YAML parsers can be can be used instead of eval, however, it is up to you to create the Biopieces that emits, parses, and manipulates complex Biopiece records.

Only use complex records if you really must. Often it is better to rethink the approach so it can be handled with the ordinary Biopiece records format.

Howto use Biopieces with GNU Parallel

For some tasks it is possible to use GNU Parallel which allow execution of Biopieces in parallel using multiple CPUs on multiple computers.

In brief, GNU Parallel works by reading from a pipe the content of e.g. a FASTA file which is then divided into chunks for which a Biopieces pipeline is executed on a separate CPU with the output written to stdout so that it may be redirected to an output file.

Example processing multiple FASTA files

Here is an example where we use GNU Parallel to process a list of FASTA files:

-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test1.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test2.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test3.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test4.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test5.fna
parallel 'read_fasta -i {} | extract_seq -l 5 | write_fasta -o {.}_trim.fna -x' ::: *.fna

And the result:

-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test1.fna
-rw-r--r--  1 maasha users  558 Sep 12 14:00 test1_trim.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test2.fna
-rw-r--r--  1 maasha users  558 Sep 12 14:00 test2_trim.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test3.fna
-rw-r--r--  1 maasha users  558 Sep 12 14:00 test3_trim.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test4.fna
-rw-r--r--  1 maasha users  558 Sep 12 14:00 test4_trim.fna
-rw-r--r--  1 maasha users 1395 Sep 12 12:25 test5.fna
-rw-r--r--  1 maasha users  558 Sep 12 14:00 test5_trim.fna

Example processing a FASTQ file

In the below example we use the power of GNU Parallel to grab in a huge FASTQ file, we use cat and read_fastq -i - where the use of -i - which allows [read_fastq] to read raw FASTQ data from stdin to parallel which gives a solid performance boost when using parallels --pipe switch and -L 4 to indicate a FASTQ entry of four lines. This allows parallel to correctly divide the raw FASTQ stream into even sized chunks. Following all the arguments is the Biopieces pipeline that we want to run - and the result is collected in out.fq:

NB this requires parallel version >= 20130222 - or it will be very slow

cat in.fq |
parallel --block 100M -k --pipe -L 4 "read_fastq -i - | grab -k SEQ_NAME -p ':Y:' | write_fastq -x"
> out.fq

Example processing multiple FASTQ files

To setup a complete Biopieces pipeline for heavy duty tasks it is best done by writing a shell script with the Biopieces commands and execute this script using GNU Parallel.

Here is an example script illumina_trim_filt.sh that does quality trimming and filtering of Illumina data:

#!/bin/sh

read_fastq -e base_33 -i - |                                              # Read in raw FASTQ data from stdin.
grab -ip ":Y:" -k SEQ_NAME |                                              # Filter reads flagged by CASAVA.
find_adaptor -l 1 -L 1 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTCT | # Find adaptors including partial adaptors.
clip_adaptor |                                                            # Clip found adaptors.
trim_seq |                                                                # End trim sequences.
grab -e 'SEQ_LEN >= 50' |                                                 # Filter reads shorter than 50 bp.
mean_scores |                                                             # Calculate mean quality score.
grab -e "SCORES_MEAN >= 20" |                                             # Filter reads with score mean below 20.
mean_scores -l |                                                          # Calculate local mean quality score.
grab -e "SCORES_MEAN_LOCAL >= 15" |                                       # Filter reads with local score mean below 15.
write_fastq -x                                                            # Write raw FASTQ data to stdout.

Save the script in a file illumina_trim_filt.sh and make it executable:

chmod +x illumina_trim_filt.sh

Notice that this script reads and writes raw FASTQ data and thus the Biopieces part is abstracted away.

Now the script can be tested:

cat data.fq | illumina_trim_filt.sh > data_trim_filt.fq

And parallized:

parallel --pipe --block 100M -k -L 4 'cat {} | illumina_trim_filt.sh > {.}_trim_filt.fq' ::: *.fq

Example processing pair-end FASTQ files

First we need to Interleaving the sequences see [Howto interleave pair-end sequences].

Next we replace the illumina_trim_filt.sh script in [Example processing multiple FASTQ files] with the following:

#!/bin/sh

read_fastq -e base_33 -i - |                                             # Read in interleaved FASTQ data from stdin.
trim_seq -m 25 -l 3 |                                                    # End trim sequences.
find_adaptor -l 6 -L 6 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTC | # Find adaptors including partial adaptors.
clip_adaptor |                                                           # Clip found adaptors.
merge_pair_seq |                                                         # Merge sequence pairs.
grab -e 'SEQ_LEN_LEFT >= 30' |                                           # Filter reads shorter than 30 bp.
grab -e 'SEQ_LEN_RIGHT >= 30' |                                          # Filter reads shorter than 30 bp.
mean_scores -l |                                                         # Calculate local mean quality score.
grab -e 'SCORES_MEAN_LOCAL >= 15' |                                      # Filter reads with local score mean below 15.
split_pair_seq |                                                         # Split sequence pairs.
write_fastq -x                                                           # Write interleaved FASTQ data to stdout.

Finally, we can feed the interleaved data to parallel making sure we split in blocks with an equal amount of reads using -L 8:

cat interleaved.fq | parallel --pipe --keep-order --block 50M -L 8 ./illumina_trim_filt.sh > clean.fq

See also [Howto clean pair-end sequences].

Creating new Biopieces

Howto write usage information

The usage information for the Biopieces is the help text you get when running a Biopiece with no arguments, or if you are browsing the Biopieces online on the wiki http://code.google.com/p/biopieces/w/list. The usage information is written in Google wiki format http://code.google.com/p/support/wiki/WikiSyntax which means that the usage information is rendered nicely in HTML on the wiki (e.g. [http://code.google.com/p/biopieces/wiki/align_seq align_seq]) and a specific Biopieces [print_wiki] renders a nice ASCII-text version. This means that you as a developer only need to call the [print_wiki] Biopiece to render the usage information independent of programming language:

print_wiki [options] -i <usage file.wiki>

See [print_wiki] for more details.

The usage information exists in one wiki file per Biopiece. For an example the wiki file for the [align_seq] is located here:

~/biopieces/bp_usage/align_seq.wiki

or using the $BP_DIR environment variable:

$BP_DIR/bp_usage/align_seq.wiki

The basename of the wiki page must be the same as the Biopieces i.e. align_seq for the above example.

When creating a new Biopieces start by copying an existing wiki file and edit the content. Do not change the structure of the wiki file - all the sections are mandatory.

Do try to re-use the option names - both the full option name and and the single character name.

The argument options are devided into different catagories that are used for argument checking:

  • flag - the option is a flag and does not take an argument.
  • string - the argument is a string.
  • list - the argument is a comma separated string with no whitespace.
  • int - the arguemnt is a integer - both signed and unsigned including 0.
  • uint - the argument is a unsigned integer i.e. only positive integers including 0.
  • float - the arguemnt is a decimal number.
  • file - the argument is a file.
  • file! - the arguemnt is a file that must exist.
  • files - the argument is a comma separated list of files or file glob expressions..
  • files! - same as the above, but the resulting files must all exist.
  • dir - the argument is a directory.
  • dir! = the argument is a directory that must exist.
  • genome - the argument is a genome that must be formatted with [format_genome]).

Remember that there are four ubiquis option names - both long and short - that are reserved:

[-?        | --help]               #  Print full usage description.
[-I <file> | --stream_in=<file!>]  #  Read input stream from file  -  Default=STDIN
[-O <file> | --stream_out=<file>]  #  Write output stream to file  -  Default=STDOUT
[-v        | --verbose]     

Note that flag type options are left blank in the wiki files.

Howto create a Biopiece using Perl

First copy and modify an existing wiki page, see [Howto write usage information].

Copying existing code

Use the code from a related Biopiece as template if possible, or use one of the simple ones such as [split_vals] as template.

cp $BP_BIN/split_vals $BP_BIN/<new Biopiece>

A stripped down Biopiece

After stripping down the part of the code omitting the parts that were specific to the function of [split_seq] we end up with this very basic Biopiece (without the line numbering):

  1 #!/usr/bin/env perl
  2 
  3 # Copyright (C) 2007-2009 Martin A. Hansen.
  4 
  5 # This program is free software; you can redistribute it and/or
  6 # modify it under the terms of the GNU General Public License
  7 # as published by the Free Software Foundation; either version 2
  8 # of the License, or (at your option) any later version.
  9 
 10 # This program is distributed in the hope that it will be useful,
 11 # but WITHOUT ANY WARRANTY; without even the implied warranty of
 12 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 13 # GNU General Public License for more details.
 14 
 15 # You should have received a copy of the GNU General Public License
 16 # along with this program; if not, write to the Free Software
 17 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
 18 
 19 # http://www.gnu.org/copyleft/gpl.html
 20 
 21 
 22 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> DESCRIPTION <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 23 
 24 # Split the values of a key into new key/value pairs.
 25 
 26 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 27 
 28 use warnings;
 29 use strict;
 30 use Maasha::Biopieces;
 31 
 32 
 33 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 34 
 35 
 36 my ( $options, $in, $out, $record, @vals, $i );
 37 
 38 $options = Maasha::Biopieces::parse_options(
 39     [
 40         { long => 'key',     short => 'k', type => 'string', mandatory => 'yes', default => undef, allowed => undef, disallowed => undef },
 41         { long => 'keys',    short => 'K', type => 'list',   mandatory => 'no',  default => undef, allowed => undef, disallowed => undef },
 42         { long => 'delimit', short => 'd', type => 'string', mandatory => 'no',  default => '_',   allowed => undef, disallowed => undef },
 43     ]
 44 );
 45 
 46 $in  = Maasha::Biopieces::read_stream( $options->{ "stream_in" } );
 47 $out = Maasha::Biopieces::write_stream( $options->{ "stream_out" } );
 48 
 49 while ( $record = Maasha::Biopieces::get_record( $in ) )
 50 {
 51     Maasha::Biopieces::put_record( $record, $out );
 52 }   
 53 
 54 Maasha::Biopieces::close_stream( $in );
 55 Maasha::Biopieces::close_stream( $out );
 56 
 57 
 58 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 59 
 60 
 61 BEGIN
 62 {
 63     Maasha::Biopieces::status_set();
 64 }   
 65 
 66 
 67 END
 68 {
 69     Maasha::Biopieces::status_log();
 70 }   
 71 
 72 
 73 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 74 
 75 
 76 __END__

The different sections of the Biopiece explained

Let us go over the different sections in this minimalistic Biopiece:

Hashbang line

Line 1. First we have the hashbang line #!/usr/bin/env perl, note that we use env perl and not a fixed path!

GPL License

Lines 3-19. Next we have the license text.

Description

Lines 22-26. This section contains a short description that typically is a copy of the Summary section from the wiki file.

Include section

Lines 28-30. Here we have a section with use statements. We always have the use warnings and use strict pragmas enabled in Perl, and the use Maasha::Biopieces; enables subroutines from this module, that also always is included. You can include other modules as well. A lot of useful existing modules can be located in $BP_PERL or ~/biopieces/code_perl/. The best way to locate useful modules is to look at the modules included by related Biopieces.

Options

Lines 38-44. In this section the Maasha::Biopieces::parse_options subroutine call is of particular interest since this contains the information on the options and their arguments. The argument to the subroutine is a list of hash references. In this particular example the Biopiece have three options apart from the mandatory 4 options that are included in all Biopieces:

The three options specific to the [split_vals] Biopiece:

$options = Maasha::Biopieces::parse_options(
    [
        { long => 'key',     short => 'k', type => 'string', mandatory => 'yes', default => undef, allowed => undef, disallowed => undef },
        { long => 'keys',    short => 'K', type => 'list',   mandatory => 'no',  default => undef, allowed => undef, disallowed => undef },
        { long => 'delimit', short => 'd', type => 'string', mandatory => 'no',  default => '_',   allowed => undef, disallowed => undef },
    ]
);

The four mandatory options added to the $options hash reference when calling Maasha::Biopieces::parse_options:

{ long => 'help',       short => '?', type => 'flag',  mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'stream_in',  short => 'I', type => 'file!', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'stream_out', short => 'O', type => 'file',  mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'verbose',    short => 'v', type => 'flag',  mandatory => 'no', default => undef, allowed => undef, disallowed => undef },

The different keys are:

  • long The long option name - do reuse sensible names from other Biopieces!
  • short The short option name - do reuse sensible names from other Biopieces!
  • type See the type explanations in the [Howto write usage information] section.
  • mandatory Indicate if the option must have an argument.
  • default Allow a default value or a comma seperated string of values depending on the type.
  • allowed Allow a comma seperated string of allowed arguments.
  • disallowed A comma seperated string of arguments not allowed.

If you need more advanced argument checking than the parse_options subroutine provides, you will have to do it yourself after parse_options is called. For an example:

Maasha::Common::error( qq(both --database and --genome specified) ) if     $options->{ "genome" } and     $options->{ "database" };
Maasha::Common::error( qq(no --database or --genome specified) )    if not $options->{ "genome" } and not $options->{ "database" };

If your Biopiece does not need any non-mandatory options you just call parse_options with no arguments like this:

$options = Maasha::Biopieces::parse_options();

Opening filehandles to the data stream

Lines 46-47. Here we open filehandles to incomming data from file or STDIN and outgoing data to file or STDOUT.

Main iterativive loop

Lines 49-52. Here we have the main iterative loop of the Biopiece. You can manipulate the $record hash references from the data stream.

Closing filehandles to the data stream

Lines 54-55. Here we close the filehandles to the data stream.

BEGIN and END actions

Lines 61-70. The BEGIN section sets the status file before anything else happens. The END section reads the status file and at the end of the Biopiece execution write the Biopiece log entry to the log file.

subroutines

If you want to modulate your code, which is always a good idea, you can place subroutines in a section beginning at line 57. Or better still. Write a Module and place in ~/biopieces/code_perl/<your_username>/ and include this module in the include section lines 29-30.

temporary data

If you need temporary files you can get a temporary directory using the subroutine Maasha::Biopices::get_tmpdir() that creates a directory in the $BP_TMP directory based on username and session id. The path to this temporary directory is returned, and the directory is automagically destroyed when the Biopieces execution is done - also, if the Biopiece is interupted the now stale temporary directory will be cleaned out when any other Biopiece is executed.

$tmp_dir = Maasha::Biopieces::get_tmpdir();

verbose messages

Use the verbose option to allow for messages to show progress or debug:

$count = 1;

while ( $record = Maasha::Biopieces::get_record( $in ) )
{
    Maasha::Biopieces::put_record( $record, $out );

    print STDERR "Records processed: $count\n" if $options->{ 'verbose' } and $count % 1000 == 0;
    $count++;
}   

adding some tests

Finally, add some tests to the Biopieces testing suite to check that everything is working. See [Howto write tests for the Biopieces test suite].

Howto create a Biopiece using Ruby

First copy and modify an existing wiki page, see [Howto write usage information].

Copying existing code

Use the code from a related Biopiece as template if possible, or use one of the simple ones such as [swapcase_seq] as template.

cp $BP_BIN/swapcase_seq $BP_BIN/<new Biopiece>

The code

The [swapcase_seq] Biopiece is very simple and the code is showed below:

  1 #!/usr/bin/env ruby
  2 
  3 # Copyright (C) 2007-2011 Martin A. Hansen.
  4 
  5 # This program is free software; you can redistribute it and/or
  6 # modify it under the terms of the GNU General Public License
  7 # as published by the Free Software Foundation; either version 2
  8 # of the License, or (at your option) any later version.
  9 
 10 # This program is distributed in the hope that it will be useful,
 11 # but WITHOUT ANY WARRANTY; without even the implied warranty of
 12 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 13 # GNU General Public License for more details.
 14 
 15 # You should have received a copy of the GNU General Public License
 16 # along with this program; if not, write to the Free Software
 17 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
 18 
 19 # http://www.gnu.org/copyleft/gpl.html
 20 
 21 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 22 
 23 # This program is part of the Biopieces framework (www.biopieces.org).
 24 
 25 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> DESCRIPTION <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 26 
 27 # Swap lower case sequence to uppercase and visa versa for all sequences in the stream.
 28 
 29 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 30 
 31 
 32 require 'maasha/biopieces'
 33 
 34 options = Biopieces.options_parse(ARGV, cast = [])
 35 
 36 Biopieces.open(options[:stream_in], options[:stream_out]) do |input, output|
 37   input.each_record do |record|
 38     record[:SEQ].swapcase! if record.has_key? :SEQ
 39     output.puts record
 40   end
 41 end
 42 
 43 
 44 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
 45 
 46 
 47 __END__

The different sections of the Biopiece explained

Let us go over the different sections in this minimalistic Biopiece:

Hashbang line

Line 1. First we have the hashbang line #!/usr/bin/env ruby, note that we use env ruby and not a fixed path!

GPL License

Lines 3-19. Next we have the license text.

Description

Lines 21-29. This section contains a short description that typically is a copy of the Summary section from the wiki file.

Require statements

Line 32. Here we have a section with require statements. We always have the require 'biopieces' line and you are free to require other classes or modules.

Casts check and option parsing

Line 34. In this section we can define option casts, which instructs the Biopiece how to handle command line options. These casts are added to the 4 mandatory options that are included in all Biopieces:

{:long => 'help',       :short => '?', :type => 'flag',   :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'stream_in',  :short => 'I', :type => 'files!', :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'stream_out', :short => 'O', :type => 'file',   :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'verbose',    :short => 'v', :type => 'flag',   :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}

The different keys are:

  • :long The long option name - do reuse sensible names from other Biopieces!
  • :short The short option name - do reuse sensible names from other Biopieces!
  • :type See the type explanations in the [Howto write usage information] section.
  • :mandatory Indicate if the option must have an argument.
  • :default Allow a default value or a comma seperated string of values depending on the type.
  • :allowed Allow a comma seperated string of allowed arguments.
  • :disallowed A comma seperated string of arguments not allowed.

Also, the command line options are passed according to the specified casts. If you need more advanced option checking than provided by biopieces.rb, you will have to do it yourself after bp.parse, e.g.:

raise "both --database and --genome specified" if     options.has_key? "genome" and     options.has_key? "database"
raise "no --database or --genome specified"    if not options.has_key? "genome" and not options.has_key? "database"

Main iterativive loop

Lines 36-41. Here we have the main iterative loop of the Biopiece demonstrating how to manipulate records read from input and written to output.

temporary data

If you need temporary files you can get a temporary directory by calling Biopieces.mktmpdir which will create a directory in the $BP_TMP directory based on username and session id. The path to this temporary directory is returned, and the directory is automagically destroyed when the Biopieces execution is done - also, if the Biopiece is interupted the now stale temporary directory will be cleaned out when any other Biopiece is executed.

verbose messages

Use the verbose option to allow for messages to show progress or debug:

$stderr.puts "Verbose message" if options.has_key? "verbose"

adding some tests

Finally, add some tests to the Biopieces testing suite to check that everything is working. See [Howto write tests for the Biopieces test suite].

Howto create a Biopiece using Python

To be written ...

Howto create a Biopiece using C

To be written ...

Howto write tests for the Biopieces test suite

The advantage of having a testing suite is that it will alert you to any bugs accidently introduced in the code during further development of the Biopieces. Basically testing is done by having an input and a verified result file used for testing a single Biopiece at a time. The input file, which is typically a stream which is read with the -I switch is read with the Biopieces subject to testing and the output is written to a temporary file with the -O option. The testing suite checks if the temporary file and the result file are identical. If they are identical, the test is OK otherwise it is a FAIL. Biopieces for parsing different types of data will not be reading data from a stream file, but rather from a sample file with the appropriate data using the -i switch e.g. a FASTA file in the case of [read_fasta]. Similary, Biopieces for writing different types of data will be outputting that data using the -o switch. Sample files are loced in $BP_DIR/bp_test/in and result files in $BP_DIR/bp_test/out while the actual test files are located in $BP_DIR/bp_test/test. A minimal structure of the $BP_DIR/bp_test directory is showed below:

$BP_DIR/bp_test/
|-- in
|   |-- align_seq.in
|   |-- grab.in
|   |-- grab.in.pat
|   |-- read_fasta.in
|   `-- write_fasta.in
|-- lib
|   `-- test.sh
|-- out
|   |-- align_seq.out.1
|   |-- grab.out.1
|   |-- grab.out.2
|   |-- read_fasta.out.1
|   |-- read_fasta.out.2
|   |-- write_fasta.out.1
|   `-- write_fasta.out.2
|-- test
|   |-- test_align_seq
|   |-- test_grab
|   |-- test_read_fasta
|   `-- test_write_fasta
`-- test_all

The tests are written as shell scripts, but are really simple. Lets look at the test for [align_seq] located here $BP_DIR/bp_test/test/test_align_seq:

#!/bin/bash

source "$BP_DIR/bp_test/lib/test.sh"

run "$bp -I $in -O $tmp"
assert_no_diff $tmp $out.1
rm $tmp

This test file contains a shebang line (the one starting with #!) and a source line that make sure the variables $bp, $in, $out, and $tmp are set. Finnally the test file contains, in this case, only one test. The test consists of a run command, a assert_no_diff command, and the rm command. The run command allows us to write a Biopiece command in short hand. In the above example we will in fact run the command:

align_seq -I /Users/maasha/biopieces/bp_test/in/align_seq.in -O /Users/maasha/BP_TMP/align_seq.out.1

The $bp variable contains the name of the Biopiece based on the name convention used (the Biopiece tested is prefixed with test_ like in test_align_seq). The $in variable contains the path to the input file and the $tmp variable contains the path to a temporary file for outputting the test result. If we are running multiple tests that give different output we postfix the files with a forthrunning number.

The assert_no_diff command checks if the resulting $tmp file differs from the validated $out file, and the result is OK if the files are identical, otherwise the result is FAIL.

Finally, the rm command is used to remove the $tmp file.

Here is an example of the output of the testing suite:

maasha@mel:~$ $BP_DIR/bp_test/test_all

Testing align_seq -I /Users/maasha/biopieces/bp_test/in/align_seq.in -O /Users/maasha/BP_TMP/align_seq.out.1 ... OK
Testing grab -I /Users/maasha/biopieces/bp_test/in/grab.in -p SEQ -O /Users/maasha/BP_TMP/grab.out.1 ... OK
Testing grab -I /Users/maasha/biopieces/bp_test/in/grab.in -p SEQ,COUNT -O /Users/maasha/BP_TMP/grab.out.2 ... OK
Testing read_fasta -i /Users/maasha/biopieces/bp_test/in/read_fasta.in -O /Users/maasha/BP_TMP/read_fasta.out.1 ... OK
Testing read_fasta -i /Users/maasha/biopieces/bp_test/in/read_fasta.in -n 1 -O /Users/maasha/BP_TMP/read_fasta.out.2 ... OK
Testing write_fasta -I /Users/maasha/biopieces/bp_test/in/write_fasta.in -o /Users/maasha/BP_TMP/write_fasta.out.1 -x ... OK
Testing write_fasta -I /Users/maasha/biopieces/bp_test/in/write_fasta.in -w 4 -o /Users/maasha/BP_TMP/write_fasta.out.2 -x ... OK
Biopieces tested: 4   Tests run: 7   OK: 7   FAIL: 0   Time: 1 secs

Howto get a Biopiece included at www.biopieces.org

Submit your Biopiece and wiki page to mail@maasha.dk and it will be included after a review.

Clone this wiki locally