Oligonucleotide Off Target Atlas

The exact off-target atlas of the nucleic-acid medicines

Every nucleic-acid substance the US public substance registry publishes a usable sequence for — not a list of drugs anyone remembered — screened against every window of the whole human transcriptome, exactly. One integer per window per strand. No sampling, no cutoff inside the computation, no parameter to choose.

The question, and why it does not expire

A trial reads out and a drug is approved, or it is not. This is a different question, and it stays true either way:

Besides its target, where else in the human transcriptome can this molecule bind well enough to matter?

Watson–Crick complementarity is a discrete rule, so it is counted rather than estimated. Bases are integers; an antisense strand binds antiparallel, so position i of the drug pairs with position L−1−i of the window, and a position pairs exactly when the two codes sum to 3. Every window of every transcript is enumerated.

strands screened    : 472
substances          : 350
transcripts scanned : 670670
windows enumerated  : per strand LENGTH — a 20-mer has 1467336203 scoreable windows

That last line was corrected on 2026-09-06. It previously read 1467336293, presented as a property of the run. It was neither: the count is a function of strand LENGTH, and only strand index 0 incremented the counter, so the figure named one arbitrary strand — and it was inflated by windows containing an N that the mismatch early-exit reached before the invalid-base check. No off-target list, no histogram bucket and no seal moved, because a window at or above the report floor never takes that exit and the sealed transcript covers the histograms and the hit lists, not the below-floor bucket. The repair decides window cleanliness once per transcript, independent of any strand scanning order. It was found by a second, independently written screen disagreeing by 99 windows while agreeing exactly on all nine scored buckets.

Why the scope is the registry and not a list

The first version of this screen covered 33 medicines from a list written from memory. That is a real defect in a safety artifact and it is not one any harness can catch: a drug nobody recalls is simply absent from the map, silently. The arithmetic would have been correct and the coverage would have been wrong.

So the registry is enumerated instead. NCATS GSRS holds 742 substances of class nucleicAcid; 740 carry at least one sequence; and the ones whose every subunit falls in the 8–60 nt range this screen can handle give 472 strands across 350 substances. The enumeration provably contains every one of the original 33.

The rest are refused with the reason recorded: 388 are outside the oligonucleotide length range — vectors, plasmids, genes and mRNA vaccines, which are mechanistically different and not what a 20-mer complementarity screen is about — 2 carry no sequence, and 2 carry a residue this program will not interpret.

A note on the word approved. The registry's status field means a curator validated the record. It does not mean the substance is a marketed medicine. This page reports the field verbatim and makes no marketing claim; which of these are approved drugs is a question for a label, not for this registry field.

The target is measured, not declared

A screen that needs you to tell it the target cannot enumerate a registry, because most substances carry no target annotation. So the target is read out of the transcriptome: a strand's measured target is the set of genes carrying its perfect complement, and off-targets are the qualifying windows outside that set.

A strand with no perfect complement anywhere gets no off-target list. Its published sequence and the transcriptome disagree, and that is reported rather than worked around.

	strands
perfect complement found — screened	187
no perfect complement anywhere — not screened	285

The honest reasons for the second row are ordinary: the registry publishes the sense strand of a double-stranded drug and its partner is the one that finds the target; the target is viral or otherwise absent from GENCODE; the molecule is an aptamer, which binds a protein and not a transcript, so complementarity has nothing to say about it; or the sequence carries chemistry a string of bases cannot represent.

That the aptamers fail is the point rather than a defect. An instrument that returned an off-target list for an aptamer would be wrong, and they are in the table so it can be seen not to.

The guide strand of a double-stranded siRNA is identified the same way — by measurement. For olpasiran the screen says strand 2, and nobody told it.

What the screen found

Of the 187 strands with a measured target, 18 have no window anywhere else in the transcriptome reaching the reporting threshold, and 169 do.

substance	UNII	length	measured target	off-target windows ≥16
`ELUFORSEN`	V30WFP6S2Y	33	CFTR	8892509
`ELUFORSEN-SODIUM`	RIY0DS613M	33	CFTR	8892509
`ETEPLIRSEN`	AIW6036FAS	30	DMD	1650921
`Rostudirsen`	3AR55D4G2D	30	DMD	1650921
`RADAVIRSEN`	9P30PF804H	30	DMD	1650921
`VESLETEPLIRSEN`	F6U7EZ3N1Q	30	DMD	1650921
`LUFEPIRSEN`	OKA0O253JZ	30	GJA1,GJA1P1	1489738
`DIDC-OLIGONUCLEOTIDE`	UKO9UZ8TJO	26	ABCB7,ABCC6,ABLIM1 +981	756695
`VO-659-free-acid`	59SHF443XA	21	AFF3,AGO1,ANK2 +138	180729
`Cysteinyl-zotadirsen`	FY4SL5AU9C	26	DMD	127545
`Zotadirsen`	K4T33W5J4B	26	DMD	127545
`VARODARSEN`	IU91PBD829	25	DMD	106192
`Pixofisiran.2`	O5QC3YP0M7	25	TGFB1	103706
`Pixofisiran-sodium.2`	8QFS4BAH6H	25	TGFB1	103706
`DEMATIRSEN`	51FM0REX6F	25	DMD	103411
`GOLODIRSEN`	033072U4MZ	25	DMD	103411
`ABETIMUS.2`	P3UVQ22SHK	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS-SODIUM.2`	F5Y7739G6U	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS.3`	P3UVQ22SHK	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS.4`	P3UVQ22SHK	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS-SODIUM.4`	F5Y7739G6U	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS.5`	P3UVQ22SHK	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS-SODIUM.5`	F5Y7739G6U	20	AAK1,ABCB7,ABCC13 +1341	100934
`ABETIMUS-SODIUM.6`	F5Y7739G6U	20	AAK1,ABCB7,ABCC13 +1341	100934
`LIXADESIRAN.2`	P3CNL1GL6K	25	PTGS2	99502
`LIXADESIRAN-SODIUM.2`	62204K0Y95	25	PTGS2	99502
`Pixofisiran-sodium.1`	8QFS4BAH6H	25	CCDC97	92319
`Pixofisiran.1`	O5QC3YP0M7	25	CCDC97	92319
`ABETIMUS.7`	P3UVQ22SHK	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS-SODIUM.7`	F5Y7739G6U	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS.8`	P3UVQ22SHK	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS-SODIUM.8`	F5Y7739G6U	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS.1`	P3UVQ22SHK	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS-SODIUM.1`	F5Y7739G6U	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS-SODIUM.3`	F5Y7739G6U	20	ABCC4,ABCG8,ABHD3 +1134	59798
`ABETIMUS.6`	P3UVQ22SHK	20	ABCC4,ABCG8,ABHD3 +1134	59798
`INCLISIRAN-SODIUM.2`	UPC6BTX7PY	23	PCSK9	44786
`INCLISIRAN.2`	UOW2C71PG5	23	PCSK9	44786
`ATU-027.2`	IFJ2SAK127	23	PKN3	33762
`LUMASIRAN-SODIUM.2`	67P6XH37HD	23	HAO1	26282

129 further strands carry off-target windows; the program prints them all.

The seal

The screen was sharded by strand, never by transcript: every shard reads the entire transcriptome and every strand is scored against every window, so splitting the strand list changes no number. The published seal is the sha256 of the eight shard seals in order, each of which already covers its own strands over the whole corpus.

MARKER  OLIGO_OFFTARGET_ATLAS_EXACT__COMPLETE_ENUMERATION_IS_OBSERVER_INVARIANT
sha256  321b36c694b89a45bb81668d7ea62b9c85cf0b3087e18bba586f43b230274b08

shard seals, in order:

  0  825185d81c520a6adccf2ef3f6643e5537237e8c172ae6137a9260b0eba8c0fe
  1  5789afba0b6ae89e65edfa2283e7bc312c5025b7069339f11ba5931caab5b871
  2  3f7903728632cab384f10d2c6ac936e04f6bb0c1144c869b1481b10749c6d516
  3  477d9d01349bcdcfbeed1df4c73dd4c4f0eb6611804bf4dd02809b5aa103e508
  4  401a1452c65c01bed97bd4cf646d2533765e40e22af34507874f1c82bea87d54
  5  1d56bfe60288cdd980e622d286d604bf102326fcbeda042d6cfae2138682cc7e
  6  dd9899e2908b7a1977ee83335f346e864b4ac0139c12972138245cad0ff5c968
  7  206d29aa4a64037ad6a8bdfb7bf7ff4ebad309254d50f892656d0d288dda4809

The transcriptome is GENCODE v50, pinned by digest so a reader can confirm they hold the same bytes: 5a320f524d73b5793518eb19b118829033713443d0f42af20a67bb31cc06cf56. Pelacarsen's sequence TGCTCCGTTGGTGCTTGTTC is in the table and reaches LPA, which is the same result the independent single-drug screen in Study 26 reached.

Reproduce

git clone https://github.com/gaiaftcl-sudo/uum8dSolarResearch.git
cd uum8dSolarResearch
swiftc -O reproduce/oligo-offtarget-atlas-exact.swift -o /tmp/atlas
curl -sL https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/latest_release/gencode.v50.transcripts.fa.gz \
  | gunzip -c | /tmp/atlas corpus/oligo-atlas/all_nucleicacid.tsv

No account, no key, no data-use agreement, and no floating point in the exact path.

What this is not

This is a map, not a verdict on any medicine. A window that pairs 17 of 20 is a place the chemistry could bind; whether it does, in a cell, at a dose, is a different question that needs a laboratory and is not answered here. Nothing on this page is medical advice, and nothing here says any substance is unsafe — several are approved medicines people depend on today. What the page provides is the exact, complete, re-derivable enumeration any such conversation should start from, available to anyone without permission and without trusting us.

Rights — source-available, not open-source

This wiki and its programs are published source-available: the source is visible so anyone can inspect it and re-derive every figure. That visibility grants no rights. The repository carries no LICENSE, which under default copyright means all rights are reserved. Any other use requires a separate written licensing agreement with the authors.

Rights — source-available, all rights reserved. This wiki and its repository are published for public inspection and to let anyone re-derive the figures. They carry no LICENSE; under default copyright, all rights are reserved. No right is given or intended to use, run, or deploy it for any purpose other than re-deriving the published figures, nor to modify or build on it — any other use requires a written licensing agreement with the authors. · Affine.Earth · zero float · zero shear

🧬 CURES — read in this order

Each step is the reason the next one exists. Nothing here is medical advice, and no page calls any medicine safe or unsafe.

1 · Why an exact safety screen at all

Cures Without the Gatekeeper — the medicine front door: six real written medicines, one screen anyone can re-run
The library admission law — what may enter, and the 71 arms that prove it refuses. The primary artefact.

2 · The three libraries, which grow rather than close

The Library of Compound Cures — exact off-target maps for the medicines the registry publishes
The Library of Proteins — 80,080 generated sequences, novel chemical matter, graded honestly
The Library of Material Systems — what a system is, what was measured, where the law lives. C-007 absolute: no recipes

3 · The maps — every place a molecule could act, counted

The off-target atlas — every nucleic-acid medicine the registry publishes a sequence for: WHERE it can pair
The order of the bases — WHETHER THAT BURDEN IS UNUSUAL: 472 strands ranked against sixteen rearrangements of their own bases
Where else could this guide cut? — the whole human genome, counted
Designed, or forced by its own bases? — every clinical CRISPR guide, with its own composition as the control
What a public genome deposit will tell you — and four ways it will mislead a health tool first
Study 45 — which of nine billion answers a laboratory can act on — a safety review of AlphaGenome Atlas, measured live on 1,200 real variants at two genes. The headline score separates every one. The detailed tracks do not: splice-site usage hands back 950 of every 1,000 values shared with another variant at HBB and 998 at CFTR, and the shared values pile up in the quiet band where a bench clears a variant

4 · One medicine at a time

Zilganersen — the first treatment for Alexander disease, screened on the real approved sequence
A drug an AI designed — rentosertib for pulmonary fibrosis, and exactly what our instruments reach
CAR-T, halted — the verdict a regulator could re-derive
N-of-1 antisense — the only safety net at a population of one
VERVE-102 — the off-target lattice a stranger can re-derive
PM359 — prime editing, certified before anyone is dosed
Del-Zota — the one safety question that can be made exact

5 · What keeps a disease alive, and what moves it

Study 26 — master regulator bonds — 17 tumour types, 7,673 tumours; eleven compound pairs where no single agent among 20,308 cleared any
Study 20 — Rife frequency — light and frequency, measured rather than dismissed
Study 37 — five molecules — 37,910 "validated discoveries", 5 distinct molecules; why per-item validation cannot see a corpus-level defect
Are the generated cures new? — 80,080 peptides against the human proteome
Study 16 — disease type · Study 17 — chemistry InChIKey · Study 14 — protein lattice

⚖️ How to read any page here

No language model in this stack — what the answers here are made of: measured 2026-09-12, no cell runs a model process, opens a model port or holds an unmasked model unit, and a gate refuses their return
Run any study in your browser — all ninety programs open on your own device, forty-nine run there, and the run tells you whether it printed the sealed bytes
The ontology — grades, terminals, controls, and what each page may say
Zero Float · Zero Shear — the method in one page
Ask someone you trust to check this — what to hand a sceptic
Readers’ guide · Program index — all 42 studies · White paper · Roadmap
The full-grade replacement — 49 retired instruments, 4 verticals
The exactness seam — the business case
Build a study — Falcon walkthrough — how to add one yourself

🔬 The method — exact against float, domain by domain

The same move every time: take a domain where a floating-point model is the accepted instrument, compute the same quantity in exact integers, and seal the cases where the two render opposite verdicts. The subject under grading is always the instrument, never the phenomenon.

Study 48 — the atom already has an address — silicon dimers 3.840 Å apart, the smallest commanded scale on the board: a length carried in single precision mis-addresses its first atom at step 8,783; an address cannot
Study 49 — the phase code never needs π — a phase-only modulator takes 256 codes per pixel; the code is a ratio of integers
Study 50 — CMS raw data from the LHC, read exactly — CMS's 2011 collision bytes streamed from CERN Open Data into the Affine IDE and read in exact integers, every collision a hologram you can turn: 138 of 3,564 bunch slots carry 93,110 of 120,742 collisions, and in 3,854 the event record reads its slot exactly 3 lower than the pixel boards · public release
Study 55 — IceCube: the light in the ice, hit by hit — IceCube's calibrated hits read byte for byte: 4 published files, 9,749 events, 2,289,821 hits, a census seal per file
Study 47 — translation shear: the meaning that survives a language — LAW FROZEN · LIVE CLAIM, measured 2026-09-11 and again fleet-wide 2026-09-12: translation as an exact coordinate transform, charts derived in memory at every start from the raw rows of a pinned public weight file and never written down; one lattice digest on 9/9 cells, zero drift, every refusal named. The generative comparison arm is ABSENT — there is no generative translator in the stack
Study 34 — the observer-invariant verdict — why a safety verdict needs an exact law, not a bigger computer
Study 35 — the safety brain that forgets — deaf in 8.4 seconds, forgets across machines, disagrees with itself
Study 36 — the language game of Fermat's Last Theorem — guess and shear, or project
Study 40 — the number the simulation throws away — their ICO result computed as a fraction; in float the effect returns 0 at every width, and an effect returned as zero cannot be searched for
Study 41 — fifty years of solving the wrong problem — the ordering was never about time, it was about arithmetic; 177× the work and 2,400× the wrong guesses to return the answer the machine already had
Study 42 — The Exact Contract — 2.7M flood settlements in Int128 cents; the step exists and the rigidity does not
Study 29 — continuous-model shear
The lattice holds · Impact study — continuum dead · Death of continuous shear
Fourier Phantom — Anima FNO vs 11+12+13 · Stellar dynamo kill shot
QCD: freedom is dilation · UUM-8D vs IUT — WIN
Peer-review bundle · Conjecture alignment

⚡ Fusion — the energy case

We need fusion — the verdict every machine can check
Affine Fusion Control — the local exact-integer court · public release
Fusion researcher's guide
Study 33 — the fusion control verdict court

🌍 The planet, and the sky

Every season, fifty tonnes — the biosphere-safety case
The forcing nobody measures · Impact study — the SpaceX trajectory
Study 31 — the biosphere joint ledger — LIVE on the court, 9/9 cells
Study 28 — the wet-bulb threshold court — Act 1 sealed
Study 32 — the taxi-out floor court
Where humans actually yield — the fatigue curves, and where the rules already agree
Study 30 — sovereign edge pod · Manufacture contracts

🏛 Markets, money and risk

The detector that flags the whole market — a manipulation geometry in exact integers, and the regulator's own indicator scored against a legitimate quoter
Study 43 — almost every order is cancelled, and that is normal — nine sessions, three operators, two continents: 935 to 998 of every 1,000 orders that ended, ended without trading. A check that flags almost everything is a denominator, not a detector — and the stock you pick moves it further than the exchange does
Study 44 — nine billion answers, four billion ways to say them — AlphaGenome Atlas ships 9 billion predictions in single-precision floats, which hold 4.28 billion distinct values: 52 of every 100 variants MUST share a score with another. Agreement and exhaustion look identical on the wire
Study 38 — the loss-reserve triangle — a reserve is an exact rational; 481 of 482 verdicts identical in both arithmetics; the sixteen-billion figure comes from an unchecked premise
Study 39 — the actuarial domain — life, pensions, multi-state and aggregation; the margin is 8 significant digits at its tightest

⚛️ Run a court yourself

Run any study in your browser — the ▶ badge beside a program name opens it in the Studio, already built and carrying its inputs, and runs it on your machine with nothing sent back
Explore the live courts
MCP user guide — all 51 tools · Deterministic no-float courts for LLMs
Court Client — generic wasm IDE for every court · Court-client checkpoint
Coding Court — the verdict IS the artifact
Zed — the coding agent, for developers — set Zed 1.20.2 up on https://affine.earth/v1, no language model anywhere; what a turn does, the wire, the autonomous closure
Zed — Minecraft comes to life — the two-person interaction, sealed: it asks, cites, clones a sibling with a value you supply, verifies by replay; the court flips REFUSED_UNKNOWN_BUDGET → WIN
Zed — the agent that teaches the whole domain — architecture, protocols, server management and git, each answered from lines it read and instruments it ran; five closures PROVEN, and the cattle question answered with a counter the fleet did not have
Math Court on Glama · Math Court user guide · Example app — entire court
Quantum algorithms inventory · Shor witness certifier
MCP clients (public)
Glama connector
Look in the UI (no visitor data)

📒 Program ledger — every study by lifecycle

A study appears here under the state its evidence has earned, and above under the question it answers. The two are different filings of the same work, on purpose.

✅ LAW FROZEN · DATA SEALED

Study 06 — explosion vs earthquake · Study 07 — Sgr A* raw visibilities
Study 11 — Ehrhart volume · Study 12 — parallel repetition · Study 13 — Connes rigidity
Study 14 — protein lattice · Study 16 — disease type · Study 17 — chemistry InChIKey
Study 18 — material STD · Study 19 — Go First dice
Study 26 — master regulator bonds — 17 tumour types, every finding published

🔴 LIVE CLAIM — standing, not sealed

🌊 CHARTER · OPEN — the findings, published either way

Study 03 — flare SIDs — archive went dead · predictions and validations
Study 04 — tsunami vs surge — partial seal · Study 05 — Forbush decreases
Study 08 — Gaia BH1 — no corpus until DR4 · Study 10 — Fermi / dark matter — does not disprove DM
Study 15 — Skala DFT shear · Study 27 — exact nuclear scattering

Oligonucleotide Off Target Atlas

The exact off-target atlas of the nucleic-acid medicines

The question, and why it does not expire

Why the scope is the registry and not a list

The target is measured, not declared

What the screen found

The seal

Reproduce

What this is not

Related

Rights — source-available, not open-source

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!